Stem-loop sequence dre-let-7j

Accession MI0003343
Description Danio rerio let-7j stem-loop
Gene family MIPF0000002; let-7
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled let-7_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The Let-7 microRNA precursor was identified from a study of developmental timing in C. elegans, and was later shown to be part of a much larger class of non-coding RNAs termed microRNAs. miR-98 microRNA precursor from human is a let-7 family member. Let-7 miRNAs have now been predicted or experimentally confirmed in a wide range of species (MIPF000002). miRNAs are initially transcribed in long transcripts (up to several hundred nucleotides) called primary miRNAs (pri-miRNAs), which are processed in the nucleus by Drosha and Pasha to hairpin structures of about ~70 nucleotide. These precursors (pre-miRNAs) are exported to the cytoplasm by exportin5, where they are subsequently processed by the enzyme Dicer to a ~22 nucleotide mature miRNA. The involvement of Dicer in miRNA processing demonstrates a relationship with the phenomenon of RNA interference.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
   u        u            --------uu      cu u 
ggu gagguagu guuuguacaguu          uagggu  g u
||| |||||||| ||||||||||||          ||||||  | a
ccg uuccguca cagacaugucaa          gucccg  c u
   -        u            ucgaggaauu      -u u 
Get sequence
Comments

This zebrafish miRNA sequence is predicted based on homology with a verified mammalian sequence (Mihaela Zavolan, personal communication).

Genome context
Coordinates (Zv9) Overlapping transcripts
6: 41385655-41385737 [+]
sense
OTTDART00000024645 ; wdr82-001; intron 2
OTTDART00000024645 ; wdr82-001; intron 2
OTTDART00000024645 ; wdr82-001; intron 2
ENSDART00000007353 ; wdr82-001; intron 2
ENSDART00000007798 ; wdr82-201; intron 2
ENSDART00000007353 ; wdr82-001; intron 2
ENSDART00000007798 ; wdr82-201; intron 2
ENSDART00000007353 ; wdr82-001; intron 2
ENSDART00000007798 ; wdr82-201; intron 2
Database links

Mature sequence dre-let-7j

Accession MIMAT0003015
Sequence

4 - 

ugagguaguuguuuguacaguu

 - 25

Get sequence
Evidence by similarity; MI0001874