Stem-loop sequence tni-mir-181a-1

AccessionMI0003334 (change log)
Previous IDstni-mir-213
DescriptionTetraodon nigroviridis miR-181-1 stem-loop
Gene family MIPF0000007; mir-181
Stem-loop
   gcuc   c   u a   u      cu       a    gag  a 
5'     gcc cgg g aca ucaacg  gucggug guuu   cc a
       ||| ||| | ||| ||||||  ||||||| ||||   || a
3'     cgg gcc c ugu aguugc  cagcuac caaa   gg u
   ----   u   c a   u      --       -    -aa  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This Tetraodon miRNA sequence is predicted based on homology with a verified zebrafish sequence (Mihaela Zavolan, personal communication).

Genome context
Coordinates (Tetraodon8) Overlapping transcripts
1: 18565254-18565336 [-]
intergenic
Clustered miRNAs
< 10kb from tni-mir-181a-1
tni-mir-181a-11: 18565254-18565336 [-]
tni-mir-181b-11: 18565043-18565129 [-]
Database links

Mature sequence tni-miR-181a-5p

Accession MIMAT0003050
Previous IDstni-miR-181a
Sequence

14 - 

aacauucaacgcugucggugagu

 - 36

Get sequence
Evidence by similarity; MI0001380

Mature sequence tni-miR-181a-3p

Accession MIMAT0003006
Previous IDstni-miR-213;tni-miR-181a*
Sequence

55 - 

accaucgaccguugauuguacc

 - 76

Get sequence
Evidence by similarity; MI0001380