Stem-loop sequence fru-mir-181a-1

AccessionMI0003333 (change log)
Previous IDsfru-mir-213
DescriptionFugu rubripes miR-181a-1 stem-loop
Gene family MIPF0000007; mir-181
Stem-loop
   gcuc   c   u a   u      cu       a    gag  a 
5'     gcc cgg g aca ucaacg  gucggug guuu   cu a
       ||| ||| | ||| ||||||  ||||||| ||||   || a
3'     cgg gcc c ugu aguugc  cagcuac caaa   gg u
   ----   u   c a   u      --       -    -aa  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This Fugu miRNA sequence is predicted based on homology with a verified zebrafish sequence (Mihaela Zavolan, personal communication).

Genome context
Coordinates (FUGU5; GCA_000180615.2) Overlapping transcripts
HE602554.1: 9660091-9660173 [-]
intergenic
Clustered miRNAs
< 10kb from fru-mir-181a-1
fru-mir-181a-1HE602554.1: 9660091-9660173 [-]
fru-mir-181bHE602554.1: 9659865-9659951 [-]
Database links

Mature sequence fru-miR-181a-5p

Accession MIMAT0003111
Previous IDsfru-miR-181a
Sequence

14 - 

aacauucaacgcugucggugagu

 - 36

Get sequence
Evidence by similarity; MI0001380

Mature sequence fru-miR-181a-3p

Accession MIMAT0003005
Previous IDsfru-miR-213;fru-miR-181a*
Sequence

55 - 

accaucgaccguugauuguacc

 - 76

Get sequence
Evidence by similarity; MI0001380