Stem-loop sequence tni-mir-181b-1

AccessionMI0003332 (change log)
DescriptionTetraodon nigroviridis miR-181b-1 stem-loop
Gene family MIPF0000007; mir-181
Stem-loop
   --aaa  u    aucaa         cug           aa  g 
5'      gg caca     cauucauug   ucgguggguuu  cu u
        || ||||     |||||||||   |||||||||||  ||  
3'      cc gugu     guaaguagc   agucacucgag  gg a
   uagac  u    -caac         --a           aa  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This Tetraodon miRNA sequence is predicted based on homology with a verified zebrafish sequence (Mihaela Zavolan, personal communication).

Genome context
Coordinates (Tetraodon8) Overlapping transcripts
1: 18565043-18565129 [-]
intergenic
Clustered miRNAs
< 10kb from tni-mir-181b-1
tni-mir-181a-11: 18565254-18565336 [-]
tni-mir-181b-11: 18565043-18565129 [-]
Database links

Mature sequence tni-miR-181b

Accession MIMAT0003004
Sequence

14 - 

aacauucauugcugucgguggg

 - 35

Get sequence
Evidence by similarity; MI0001367