Stem-loop sequence fru-mir-181b

AccessionMI0003331 (change log)
Previous IDsfru-mir-181b-1
DescriptionFugu rubripes miR-181b stem-loop
Gene family MIPF0000007; mir-181
Stem-loop
   --aaa  u    aucaa         cug           aa  g 
5'      gg caca     cauucauug   ucgguggguuu  cu u
        || ||||     |||||||||   |||||||||||  ||  
3'      cc gugu     guaaguagc   agucacucgag  gg a
   uagac  u    -caac         --a           aa  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This Fugu miRNA sequence is predicted based on homology with a verified zebrafish sequence (Mihaela Zavolan, personal communication).

Genome context
Coordinates (FUGU5; GCA_000180615.2) Overlapping transcripts
HE602554.1: 9659865-9659951 [-]
intergenic
Clustered miRNAs
< 10kb from fru-mir-181b
fru-mir-181a-1HE602554.1: 9660091-9660173 [-]
fru-mir-181bHE602554.1: 9659865-9659951 [-]
Database links

Mature sequence fru-miR-181b

Accession MIMAT0003003
Sequence

14 - 

aacauucauugcugucgguggg

 - 35

Get sequence
Evidence by similarity; MI0001366