Stem-loop sequence fru-mir-199-2

AccessionMI0003329 (change log)
DescriptionFugu rubripes miR-199-2 stem-loop
Gene family MIPF0000040; mir-199
Stem-loop
   cc     c       u        c   u   gaag 
5'   gccug ccagugu cagacuac ugu cag    u
     ||||| ||||||| |||||||| ||| |||     
3'   cggau gguuaca gucugaug aca guu    a
   gu     u       c        -   u   ggug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This Fugu miRNA sequence is predicted based on homology with a verified zebrafish sequence (Mihaela Zavolan, personal communication).

Genome context
Coordinates (FUGU5; GCA_000180615.2) Overlapping transcripts
HE602540.1: 7219400-7219472 [+]
intergenic
Database links

Mature sequence fru-miR-199

Accession MIMAT0002959
Sequence

8 - 

cccaguguucagacuaccuguuc

 - 30

Get sequence
Evidence by similarity; MI0001373