Stem-loop sequence tni-mir-9-2

AccessionMI0003322 (change log)
DescriptionTetraodon nigroviridis miR-9-2 stem-loop
Gene family MIPF0000014; mir-9
Stem-loop
      g   uc               ---gu      g 
5' guu uua  uuugguuaucuagcu     augagu u
   ||| |||  |||||||||||||||     |||||| u
3' caa aau  aagccaauagaucga     ugcucg c
      a   ga               aauac      u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This Tetraodon miRNA sequence is predicted based on homology with a verified zebrafish sequence (Mihaela Zavolan, personal communication).

Genome context
Coordinates (Tetraodon8) Overlapping transcripts
12: 2246020-2246091 [+]
intergenic
Database links

Mature sequence tni-miR-9

Accession MIMAT0002911
Sequence

8 - 

ucuuugguuaucuagcuguauga

 - 30

Get sequence
Evidence by similarity; MI0001883