Stem-loop sequence tni-mir-301

Accession MI0003310
Description Tetraodon nigroviridis miR-301 stem-loop
Gene family MIPF0000034; mir-130
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-130_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology, miR-130 microRNA precursor is a small non-coding RNA that regulates gene expression. This microRNA has been identified in mouse (MI0000156, MI0000408), and in human (MI0000448, MI0000748). miR-130 appears to be vertebrate-specific miRNA and has now been predicted or experimentally confirmed in a range of vertebrate species (MIPF0000034). Mature microRNAs are processed from the precursor stem-loop by the Dicer enzyme. In this case, the mature sequence is excised from the 3' arm of the hairpin. It has been found that miR-130 is upregulated in a type of cancer called hepatocellular carcinoma.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop 
       c    c       ---        a   uacca 
aggucag ugcu ugacaau   guugcacu cug     u
||||||| |||| |||||||   |||||||| |||      
uccgguu acga acuguua   uaacguga gau     c
       u    u       uga        c   cuuac
Get sequence
Comments

This Tetraodon miRNA sequence is predicted based on homology with a verified zebrafish sequence (Mihaela Zavolan, personal communication).

Genome context
Coordinates (Tetraodon8) Overlapping transcripts
4: 1516052-1516130 [+]
intergenic
Clustered miRNAs
< 10kb from tni-mir-301
tni-mir-130 4: 1515774-1515847 [+]
tni-mir-301 4: 1516052-1516130 [+]

Mature sequence tni-miR-301

Accession MIMAT0002988
Sequence

48 -  

cagugcaauaguauugucauag

 - 69

Get sequence
Evidence by similarity; MI0002062