|
miRBase |
|
Stem-loop sequence fru-mir-124-1 |
|||||
| Accession | MI0003287 | ||||
| Description | Fugu rubripes miR-124-1 stem-loop | ||||
| Gene family | MIPF0000021; mir-124 | ||||
| Community annotation |
This text is a summary paragraph taken from the Wikipedia entry entitled mir-124_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ... The miR-124 microRNA precursor is a small non-coding RNA molecule that has been identified in flies (MI0000373), nematode worms (MI0000302), mouse (MI0000150) and human (MI0000443). The mature ~21 nucleotide microRNAs are processed from hairpin precursor sequences by the Dicer enzyme, and in this case originates from the 3' arm. miR-124 has been found to be the most abundant microRNA expressed in neuronal cells. Experiments to alter expression of miR-124 in neural cells did not appear to affect differentiation. |
||||
| Stem-loop |
gguugu cc a ga - u
gucucu guguucac gcg ccuugauu uaa g
|||||| |||||||| ||| |||||||| |||
uagaga cguaagug cgc ggaauuaa auu u
------ ac g ac c c
|
||||
| Comments |
This Fugu miRNA sequence is predicted based on homology with a verified zebrafish sequence (Mihaela Zavolan, personal communication). |
||||
| Genome context |
|
||||
Mature sequence fru-miR-124 |
|
| Accession | MIMAT0002896 |
| Sequence |
51 - uaaggcacgcggugaaugccaa - 72 |
| Evidence | by similarity; MI0001968 |