Stem-loop sequence fru-mir-124-1

Accession

MI0003287

Description

Fugu rubripes miR-124-1 stem-loop

Gene family

MIPF0000021; mir-124

Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-124_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia.

The miR-124 microRNA precursor is a small non-coding RNA molecule that has been identified in flies (MI0000373), nematode worms (MI0000302), mouse (MI0000150) and human (MI0000443). The mature ~21 nucleotide microRNAs are processed from hairpin precursor sequences by the Dicer enzyme, and in this case originates from the 3' arm. miR-124 has been found to be the most abundant microRNA expressed in neuronal cells. Experiments to alter expression of miR-124 in neural cells did not appear to affect differentiation.

Stem-loop

gguugu      cc        a   ga        -   u 
      gucucu  guguucac gcg  ccuugauu uaa g
      ||||||  |||||||| |||  |||||||| |||  
      uagaga  cguaagug cgc  ggaauuaa auu u
------      ac        g   ac        c   c 

Comments

This Fugu miRNA sequence is predicted based on homology with a verified zebrafish sequence (Mihaela Zavolan, personal communication).

Genome context

• Coordinates (FUGU5): HE602544.1: 4299545-4299621 [-]
• Overlapping transcripts:

  intergenic

Mature sequence fru-miR-124

• Accession: MIMAT0002896
• Sequence: 51 - uaaggcacgcggugaaugccaa - 72
• Evidence: by similarity; MI0001968