Stem-loop sequence tni-mir-365

AccessionMI0003284 (change log)
DescriptionTetraodon nigroviridis miR-365 stem-loop
Gene family MIPF0000061; mir-365
Stem-loop
   -----ca      aa        ac           -----    u   u 
5'        gcaaga  agugaggg  uuuuaggggca     gcug guu u
          ||||||  ||||||||  |||||||||||     |||| ||| a
3'        cguucu  uuauuccu  aaaauccccgu     ugac caa u
   cuguuaa      cg        -a           aauac    c   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This Tetraodon miRNA sequence is predicted based on homology with a verified zebrafish sequence (Mihaela Zavolan, personal communication).

Genome context
Coordinates (Tetraodon8) Overlapping transcripts
Un_random: 38921278-38921369 [+]
intergenic
Clustered miRNAs
< 10kb from tni-mir-365
tni-mir-193Un_random: 38919577-38919659 [+]
tni-mir-365Un_random: 38921278-38921369 [+]
Database links

Mature sequence tni-miR-365

Accession MIMAT0002968
Sequence

55 - 

uaaugccccuaaaaauccuuau

 - 76

Get sequence
Evidence by similarity; MI0002069