Stem-loop sequence fru-mir-365

AccessionMI0003283 (change log)
DescriptionFugu rubripes miR-365 stem-loop
Gene family MIPF0000061; mir-365
Stem-loop
   --------ca      aa        ac           -----    u   u 
5'           gcaaga  agugaggg  uuuuaggggca     gcug guu u
             ||||||  ||||||||  |||||||||||     |||| ||| a
3'           cguucu  uuauuccu  aaaauccccgu     ugac caa u
   caacuguuaa      cg        -a           aauac    c   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This Fugu miRNA sequence is predicted based on homology with a verified zebrafish sequence (Mihaela Zavolan, personal communication).

Genome context
Coordinates (FUGU5; GCA_000180615.2) Overlapping transcripts
HE602551.1: 1290150-1290244 [+]
intergenic
Clustered miRNAs
< 10kb from fru-mir-365
fru-mir-193HE602551.1: 1288135-1288222 [+]
fru-mir-365HE602551.1: 1290150-1290244 [+]
Database links

Mature sequence fru-miR-365

Accession MIMAT0002967
Sequence

55 - 

uaaugccccuaaaaauccuuau

 - 76

Get sequence
Evidence by similarity; MI0002069