Stem-loop sequence tni-mir-199-3

AccessionMI0003276 (change log)
DescriptionTetraodon nigroviridis miR-199-3 stem-loop
Gene family MIPF0000040; mir-199
Stem-loop
   -------c    c -    c  c       u        c      u aga 
5'         ccca c cugc ug ccagugu cagacuac uguuca c   c
           |||| | |||| || ||||||| |||||||| |||||| |    
3'         gggu g gacg au gguuaca gucugaug acaagu g   u
   cacacaca    u a    u  u       c        -      c aac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This Tetraodon miRNA sequence is predicted based on homology with a verified zebrafish sequence (Mihaela Zavolan, personal communication).

Genome context
Coordinates (Tetraodon8) Overlapping transcripts
3: 11403050-11403144 [-]
antisense
ENSTNIT00000013554 ; dnm2a-201; intron 17
Database links

Mature sequence tni-miR-199

Accession MIMAT0002960
Sequence

15 - 

cccaguguucagacuaccuguuc

 - 37

Get sequence
Evidence by similarity; MI0001373