Stem-loop sequence tni-mir-196a-2

AccessionMI0003272 (change log)
DescriptionTetraodon nigroviridis miR-196a-2 stem-loop
Gene family MIPF0000031; mir-196
Stem-loop
   ucga ug   u  gu             u   gucca 
5'     g  guu ag  aguuucauguugu ggg     u
       |  ||| ||  ||||||||||||| |||      
3'     c  uaa uc  ucaaaguacaacg cuc     u
   accc gu   u  ug             u   aaacu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This Tetraodon miRNA sequence is predicted based on homology with a verified zebrafish sequence (Mihaela Zavolan, personal communication).

Genome context
Coordinates (Tetraodon8) Overlapping transcripts
21: 3025748-3025823 [+]
intergenic
Database links

Mature sequence tni-miR-196a

Accession MIMAT0002956
Sequence

11 - 

uagguaguuucauguuguuggg

 - 32

Get sequence
Evidence by similarity; MI0001372