Stem-loop sequence tni-mir-194

AccessionMI0003260 (change log)
DescriptionTetraodon nigroviridis miR-194 stem-loop
Gene family MIPF0000055; mir-194
Stem-loop
   ----gcg g   g u         ac     g     -  ug 
5'        c cug a guaacagca  uccau uggaa gc  u
          | ||| | |||||||||  ||||| ||||| ||  a
3'        g gac u cauugucgu  aggug accuu ug  u
   ccaccua a   g c         ga     -     g  ug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This Tetraodon miRNA sequence is predicted based on homology with a verified zebrafish sequence (Mihaela Zavolan, personal communication).

Genome context
Coordinates (Tetraodon8) Overlapping transcripts
7: 7655321-7655401 [+]
intergenic
Clustered miRNAs
< 10kb from tni-mir-194
tni-mir-1947: 7655321-7655401 [+]
tni-mir-1927: 7655502-7655584 [+]
Database links

Mature sequence tni-miR-194

Accession MIMAT0002944
Sequence

11 - 

uguaacagcaacuccaugugg

 - 31

Get sequence
Evidence by similarity; MI0002033