Stem-loop sequence tni-mir-192

AccessionMI0003258 (change log)
DescriptionTetraodon nigroviridis miR-192 stem-loop
Gene family MIPF0000063; mir-192
Stem-loop
   ------c   a   ga  a     -          c   uaacu 
5'        acg ggu  ug ccuau gaauugacag cag     g
          ||| |||  || ||||| |||||||||| |||      
3'        ugc ucg  ac ggaug cuugacuguc guc     g
   cccugcc   g   uc  c     u          c   uccga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This Tetraodon miRNA sequence is predicted based on homology with a verified zebrafish sequence (Mihaela Zavolan, personal communication).

Genome context
Coordinates (Tetraodon8) Overlapping transcripts
7: 7655502-7655584 [+]
intergenic
Clustered miRNAs
< 10kb from tni-mir-192
tni-mir-1947: 7655321-7655401 [+]
tni-mir-1927: 7655502-7655584 [+]
Database links

Mature sequence tni-miR-192

Accession MIMAT0002942
Sequence

10 - 

augaccuaugaauugacagcc

 - 30

Get sequence
Evidence by similarity; MI0001371