Stem-loop sequence dre-mir-489

AccessionMI0003256 (change log)
DescriptionDanio rerio miR-489 stem-loop
Gene family MIPF0000111; mir-489
Stem-loop
   acugacu     --g     ---c   ug             c       ---   u 
5'        ugagu   guggc    ugg  gucguauguauga gucauuu   acu c
          |||||   |||||    |||  ||||||||||||| |||||||   |||  
3'        acucg   caucg    auc  cggcauguauacu cagugag   uga a
   ----acu     gua     ucaa   gu             a       guu   a 
Get sequence
Deep sequencing
286 reads, 0 reads per million, 10 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

miR-489 was predicted in zebrafish based on homology with a verified mammalian sequence (Mihaela Zavolan, personal communication), and later verified experimentally [1].

Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr19: 40781168-40781271 [-]
sense
OTTDART00000023453 ; calcr-001; intron 2
ENSDART00000051943 ; calcr-201; intron 1
ENSDART00000131471 ; calcr-001; intron 2
KZ115596.1: 146317-146420 [-]
sense
OTTDART00000023453 ; calcr-001; intron 2
ENSDART00000051943 ; calcr-201; intron 1
ENSDART00000131471 ; calcr-001; intron 2
Database links

Mature sequence dre-miR-489

Accession MIMAT0002940
Sequence

60 - 

agugacaucauauguacggcugc

 - 82

Get sequence
Deep sequencing274 reads, 10 experiments
Evidence experimental; cloned [1], Northern [1]
Database links
Predicted targets

References

1
PMID:16698962 "Cloning and expression of new microRNAs from zebrafish" Kloosterman WP, Steiner FA, Berezikov E, de Bruijn E, van de Belt J, Verheul M, Cuppen E, Plasterk RH Nucleic Acids Res. 34:2558-2569(2006).