Stem-loop sequence dre-mir-184-2

AccessionMI0003243 (change log)
DescriptionDanio rerio miR-184-2 stem-loop
Gene family MIPF0000059; mir-184
Literature search

5 open access papers mention dre-mir-184-2
(106 sentences)

Stem-loop
   ----     c         c      agcccagcuaacga 
5'     cacau uccuuauca uuuucc              u
       ||||| ||||||||| ||||||              g
3'     gugua gggaauagu aagagg              g
   gucg     c         c      cagguugccuaagu 
Get sequence
Deep sequencing
364326 reads, 2.21e+04 reads per million, 11 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This zebrafish miRNA sequence is predicted based on homology with a verified mammalian sequence (Mihaela Zavolan, personal communication).

Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr7: 30189592-30189670 [-]
intergenic
KZ115233.1: 158062-158140 [-]
intergenic
Database links

Mature sequence dre-miR-184

Accession MIMAT0001853
Sequence

49 - 

uggacggagaacugauaagggc

 - 70

Get sequence
Deep sequencing728181 reads, 11 experiments
Evidence by similarity; MI0002026
Database links
Predicted targets