Stem-loop sequence tni-mir-184

AccessionMI0003242 (change log)
DescriptionTetraodon nigroviridis miR-184 stem-loop
Gene family MIPF0000059; mir-184
Stem-loop
   cgcucacaucu        c      a c     uauag u 
5'            ccuuauca uuuucc g ccagc     c u
              |||||||| |||||| | |||||     |  
3'            ggaauagu aagagg c gguug     g c
   ----------g        c      - a     ccuaa u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This Tetraodon miRNA sequence is predicted based on homology with a verified zebrafish sequence (Mihaela Zavolan, personal communication).

Genome context
Coordinates (Tetraodon8) Overlapping transcripts
5: 2363269-2363341 [-]
intergenic
Database links

Mature sequence tni-miR-184

Accession MIMAT0002927
Sequence

53 - 

uggacggagaacugauaaggg

 - 73

Get sequence
Evidence by similarity; MI0002026