Stem-loop sequence tni-mir-19a

AccessionMI0003236 (change log)
DescriptionTetraodon nigroviridis miR-19a stem-loop
Gene family MIPF0000011; mir-19
Stem-loop
   g   uu u  gc             --      u  aagaa 
5'  cag  c cu  uaguuuugcauag  uugcac ac     u
    |||  | ||  |||||||||||||  |||||| ||      
3'  guc  g gg  gucaaaacguauc  aacgug ug     a
   -   cg u  ua             ua      u  aggag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This Tetraodon miRNA sequence is predicted based on homology with a verified zebrafish sequence (Mihaela Zavolan, personal communication).

Genome context
Coordinates (Tetraodon8) Overlapping transcripts
5: 8188589-8188669 [-]
intergenic
Clustered miRNAs
< 10kb from tni-mir-19a
tni-mir-17-15: 8188854-8188939 [-]
tni-mir-185: 8188729-8188804 [-]
tni-mir-19a5: 8188589-8188669 [-]
tni-mir-19b5: 8188259-8188335 [-]
tni-mir-92-25: 8188106-8188177 [-]
Database links

Mature sequence tni-miR-19a

Accession MIMAT0002921
Sequence

49 - 

ugugcaaaucuaugcaaaacuga

 - 71

Get sequence
Evidence by similarity; MI0001903