Stem-loop sequence tni-mir-18

AccessionMI0003234 (change log)
DescriptionTetraodon nigroviridis miR-18 stem-loop
Gene family MIPF0000001; mir-17
Stem-loop
   -        --   u   uc   u    a   -  aaau 
5'  uugugcua  agg gca  uag gcag uag ug    a
    ||||||||  ||| |||  ||| |||| ||| ||    g
3'  aauacggu  ucc cgu  auc cguc auc ac    a
   g        cu   u   ga   c    -   c  gauc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This Tetraodon miRNA sequence is predicted based on homology with a verified zebrafish sequence (Mihaela Zavolan, personal communication).

Genome context
Coordinates (Tetraodon8) Overlapping transcripts
5: 8188729-8188804 [-]
intergenic
Clustered miRNAs
< 10kb from tni-mir-18
tni-mir-17-15: 8188854-8188939 [-]
tni-mir-185: 8188729-8188804 [-]
tni-mir-19a5: 8188589-8188669 [-]
tni-mir-19b5: 8188259-8188335 [-]
tni-mir-92-25: 8188106-8188177 [-]
Database links

Mature sequence tni-miR-18

Accession MIMAT0002919
Sequence

7 - 

uaaggugcaucuagugcagaua

 - 28

Get sequence
Evidence by similarity; MI0001900