Stem-loop sequence tni-mir-17-1

AccessionMI0003232 (change log)
DescriptionTetraodon nigroviridis miR-17-1 stem-loop
Gene family MIPF0000001; mir-17
Literature search

1 open access papers mention tni-mir-17-1
(16 sentences)

Stem-loop
      -u u       -ca        a  g     g   uacua 
5' guc  g guauugc   aagugcuu ca ugcag uag     u
   |||  | |||||||   |||||||| || ||||| |||     g
3' cag  c caugacg   uucacgga gu acguc auc     u
      uu u       aca        g  a     -   cacaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This Tetraodon miRNA sequence is predicted based on homology with a verified zebrafish sequence (Mihaela Zavolan, personal communication).

Genome context
Coordinates (Tetraodon8) Overlapping transcripts
5: 8188854-8188939 [-]
intergenic
Clustered miRNAs
< 10kb from tni-mir-17-1
tni-mir-17-15: 8188854-8188939 [-]
tni-mir-185: 8188729-8188804 [-]
tni-mir-19a5: 8188589-8188669 [-]
tni-mir-19b5: 8188259-8188335 [-]
tni-mir-92-25: 8188106-8188177 [-]
Database links

Mature sequence tni-miR-17

Accession MIMAT0002917
Sequence

14 - 

caaagugcuuacagugcaggua

 - 35

Get sequence
Evidence by similarity; MI0001898