Stem-loop sequence fru-mir-17-1

AccessionMI0003231 (change log)
DescriptionFugu rubripes miR-17-1 stem-loop
Gene family MIPF0000001; mir-17
Stem-loop
      -u u       -ca        a  g     g   --u  u 
5' guc  g guauugc   aagugcuu ca ugcag uag   uc a
   |||  | |||||||   |||||||| || ||||| |||   || u
3' cag  c caugacg   uucacgga gu acguc auc   ag g
      uu u       aca        g  a     -   cac  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This Fugu miRNA sequence is predicted based on homology with a verified zebrafish sequence (Mihaela Zavolan, personal communication).

Genome context
Coordinates (FUGU5; GCA_000180615.2) Overlapping transcripts
HE602547.1: 13071306-13071391 [+]
intergenic
Clustered miRNAs
< 10kb from fru-mir-17-1
fru-mir-17-1HE602547.1: 13071306-13071391 [+]
fru-mir-18HE602547.1: 13071440-13071515 [+]
fru-mir-19aHE602547.1: 13071578-13071658 [+]
fru-mir-19bHE602547.1: 13071933-13071995 [+]
fru-mir-92-2HE602547.1: 13072087-13072149 [+]
Database links

Mature sequence fru-miR-17

Accession MIMAT0002916
Sequence

14 - 

caaagugcuuacagugcaggua

 - 35

Get sequence
Evidence by similarity; MI0001898