Stem-loop sequence tni-mir-9-1

AccessionMI0003226 (change log)
DescriptionTetraodon nigroviridis miR-9-1 stem-loop
Gene family MIPF0000014; mir-9
Stem-loop
   caga      g c     uc               g      u  cg 
5'     gggguu u uguua  uuugguuaucuagcu uaugag ga  u
       |||||| | |||||  ||||||||||||||| |||||| ||  a
3'     cccuaa a acaau  aagccaauagaucga auacuu cu  c
   auua      g -     ga               a      -  aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This Tetraodon miRNA sequence is predicted based on homology with a verified zebrafish sequence (Mihaela Zavolan, personal communication).

Genome context
Coordinates (Tetraodon8) Overlapping transcripts
21_random: 1842676-1842770 [+]
intergenic
Database links

Mature sequence tni-miR-9

Accession MIMAT0002911
Sequence

19 - 

ucuuugguuaucuagcuguauga

 - 41

Get sequence
Evidence by similarity; MI0001883