Stem-loop sequence fru-mir-9-1

AccessionMI0003225 (change log)
DescriptionFugu rubripes miR-9-1 stem-loop
Gene family MIPF0000014; mir-9
Stem-loop
         g c     uc               g      u  cg 
5' gggguu u uguua  uuugguuaucuagcu uaugag ga  u
   |||||| | |||||  ||||||||||||||| |||||| ||  a
3' cccuaa a acaau  aagccaauagaucga auacuu cu  c
         g -     ga               a      -  aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This Fugu miRNA sequence is predicted based on homology with a verified zebrafish sequence (Mihaela Zavolan, personal communication).

Genome context
Coordinates (FUGU5; GCA_000180615.2) Overlapping transcripts
HE602546.1: 9462079-9462165 [+]
intergenic
Database links

Mature sequence fru-miR-9

Accession MIMAT0002910
Sequence

15 - 

ucuuugguuaucuagcuguauga

 - 37

Get sequence
Evidence by similarity; MI0001883