Stem-loop sequence tni-mir-101a

AccessionMI0003218 (change log)
DescriptionTetraodon nigroviridis miR-101a stem-loop
Gene family MIPF0000046; mir-101
Stem-loop
   u   c gg                   a    g  cc 
5'  gcc u  uucaguuaucacagugcug ugcu uc  c
    ||| |  ||||||||||||||||||| |||| ||   
3'  cgg a  aagucaauagugucaugac augg ag  a
   -   u gg                   -    a  cu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This Tetraodon miRNA sequence is predicted based on homology with a verified zebrafish sequence (Mihaela Zavolan, personal communication).

Genome context
Coordinates (Tetraodon8) Overlapping transcripts
1: 20355612-20355685 [+]
intergenic
Database links

Mature sequence tni-miR-101a

Accession MIMAT0002903
Sequence

47 - 

uacaguacugugauaacugaag

 - 68

Get sequence
Evidence by similarity; MI0001960