Stem-loop sequence fru-mir-223

AccessionMI0003209 (change log)
DescriptionFugu rubripes miR-223 stem-loop
Gene family MIPF0000067; mir-223
Stem-loop
   ----------------cacuuagu              guucuu       uuu 
5'                         guauuugacaagcu      gacacuc   a
                           ||||||||||||||      |||||||   u
3'                         cauaaacuguuuga      cugugag   a
   gucuguucacuguggagugaaccc              ------       cgc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This Fugu miRNA sequence is predicted based on homology with a verified zebrafish sequence (Mihaela Zavolan, personal communication).

Genome context
Coordinates (FUGU5; GCA_000180615.2) Overlapping transcripts
HE602549.1: 8788558-8788646 [+]
intergenic
Database links

Mature sequence fru-miR-223

Accession MIMAT0002894
Sequence

48 - 

ugucaguuugucaaauacccc

 - 68

Get sequence
Evidence by similarity; MI0001389