Stem-loop sequence mmu-mir-532

AccessionMI0003206 (change log)
Symbol MGI:Mir532
DescriptionMus musculus miR-532 stem-loop
Gene family MIPF0000113; mir-188
Literature search

13 open access papers mention mmu-mir-532
(76 sentences)

Stem-loop
   c   uuu    u       c  u      a    a   cc  ugaca 
5'  aga   gcuu uucucuu ca gccuug gugu gga  gu     u
    |||   |||| ||||||| || |||||| |||| |||  ||     c
3'  ucu   cgaa gagagga gu cggaac caca ccu  ca     u
   c   -uc    c       c  u      c    c   cc  uuaau 
Get sequence
Deep sequencing
168276 reads, 314 reads per million, 108 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chrX: 7248402-7248497 [-]
sense
OTTMUST00000039775 ; Clcn5-003; intron 2
OTTMUST00000039776 ; Clcn5-004; intron 3
OTTMUST00000039777 ; Clcn5-005; intron 3
ENSMUST00000128319 ; Clcn5-003; intron 2
ENSMUST00000115746 ; Clcn5-004; intron 3
ENSMUST00000132126 ; Clcn5-005; intron 3
Clustered miRNAs
< 10kb from mmu-mir-532
mmu-mir-532chrX: 7248402-7248497 [-]
mmu-mir-188chrX: 7247989-7248056 [-]
mmu-mir-362chrX: 7241982-7242046 [-]
mmu-mir-501chrX: 7241243-7241351 [-]
Database links

Mature sequence mmu-miR-532-5p

Accession MIMAT0002889
Previous IDsmmu-miR-532
Sequence

21 - 

caugccuugaguguaggaccgu

 - 42

Get sequence
Deep sequencing152005 reads, 105 experiments
Evidence experimental; PCR [1], miRAP-cloned [2], cloned [3], Illumina [4-5]
Database links
Predicted targets

Mature sequence mmu-miR-532-3p

Accession MIMAT0004781
Sequence

58 - 

ccucccacacccaaggcuugca

 - 79

Get sequence
Deep sequencing16259 reads, 103 experiments
Evidence experimental; cloned [3], Illumina [4-5]
Database links
Predicted targets

References

1
"PCR-based expression analysis and identification of microRNAs" Lu DP, Read RL, Humphreys DT, Battah FM, Martin DIK, Rasko JEJ RNAi and Gene Silencing 1:44-49(2005).
2
PMID:16973894 "Mouse microRNA profiles determined with a new and sensitive cloning method" Takada S, Berezikov E, Yamashita Y, Lagos-Quintana M, Kloosterman WP, Enomoto M, Hatanaka H, Fujiwara S, Watanabe H, Soda M, Choi YL, Plasterk RH, Cuppen E, Mano H Nucleic Acids Res. 34:e115(2006).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
5
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).