Stem-loop sequence hsa-mir-532

AccessionMI0003205 (change log)
Symbol HGNC:MIR532
DescriptionHomo sapiens miR-532 stem-loop
Gene family MIPF0000113; mir-188
Literature search

51 open access papers mention hsa-mir-532
(185 sentences)

Stem-loop
   cgacuu    u    c  c  u      a    a   cc  uggca 
5'       gcuu cucu cu ca gccuug gugu gga  gu     u
         |||| |||| || || |||||| |||| |||  ||     c
3'       cgag gaga ga gu cggaac caca ccu  ca     u
   ----uc    c    a  c  u      c    c   cc  uuaau 
Get sequence
Deep sequencing
134949 reads, 322 reads per million, 159 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chrX: 50003148-50003238 [+]
sense
OTTHUMT00000056562 ; CCNB3-005; intron 1
OTTHUMT00000056558 ; CCNB3-001; intron 1
OTTHUMT00000056559 ; CCNB3-002; intron 1
OTTHUMT00000056560 ; CCNB3-003; intron 1
OTTHUMT00000056561 ; CCNB3-004; intron 2
ENST00000491907 ; CCNB3-005; intron 1
ENST00000376042 ; CCNB3-001; intron 1
ENST00000376038 ; CCNB3-002; intron 1
ENST00000476167 ; CCNB3-003; intron 1
ENST00000493507 ; CCNB3-004; intron 2
Clustered miRNAs
< 10kb from hsa-mir-532
hsa-mir-532chrX: 50003148-50003238 [+]
hsa-mir-188chrX: 50003503-50003588 [+]
hsa-mir-500achrX: 50008431-50008514 [+]
hsa-mir-362chrX: 50008964-50009028 [+]
hsa-mir-501chrX: 50009722-50009805 [+]
hsa-mir-500bchrX: 50010672-50010750 [+]
Database links

Mature sequence hsa-miR-532-5p

Accession MIMAT0002888
Previous IDshsa-miR-532
Sequence

20 - 

caugccuugaguguaggaccgu

 - 41

Get sequence
Deep sequencing114647 reads, 158 experiments
Evidence experimental; PCR [1], cloned [2-3]
Database links
Predicted targets

Mature sequence hsa-miR-532-3p

Accession MIMAT0004780
Sequence

57 - 

ccucccacacccaaggcuugca

 - 78

Get sequence
Deep sequencing20281 reads, 139 experiments
Evidence experimental; cloned [2]
Database links
Predicted targets

References

1
"PCR-based expression analysis and identification of microRNAs" Lu DP, Read RL, Humphreys DT, Battah FM, Martin DIK, Rasko JEJ RNAi and Gene Silencing 1:44-49(2005).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).