|
miRBase |
|
Stem-loop sequence hsa-mir-532 |
|||||
| Accession | MI0003205 | ||||
| Symbol | HGNC:MIR532 | ||||
| Description | Homo sapiens miR-532 stem-loop | ||||
| Gene family | MIPF0000113; mir-188 | ||||
| Stem-loop |
c a cucuccuc u a a cc uggca g cuugcuuu ca gccuug gugu gga gu u | |||||||| || |||||| |||| ||| || c c gagcgaaa gu cggaac caca ccu ca u u c ----aaac u c c cc uuaau |
||||
| Deep sequencing |
| ||||
| Genome context |
|
||||
| Clustered miRNAs | |||||
| Database links | |||||
Mature sequence hsa-miR-532-5p |
|
| Accession | MIMAT0002888 |
| Previous IDs | hsa-miR-532 |
| Sequence |
20 - caugccuugaguguaggaccgu - 41 |
| Deep sequencing | 15805 reads, 28 experiments |
| Evidence | experimental; PCR [1], cloned [2-3] |
| Validated targets |
|
| Predicted targets |
|
Mature sequence hsa-miR-532-3p |
|
| Accession | MIMAT0004780 |
| Sequence |
57 - ccucccacacccaaggcuugca - 78 |
| Deep sequencing | 1246 reads, 24 experiments |
| Evidence | experimental; cloned [2] |
| Predicted targets |
|
References |
|
| 1 |
"PCR-based expression analysis and identification of microRNAs"
RNAi and Gene Silencing 1:44-49(2005).
|
| 2 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
| 3 |
PMID:17616659
"Patterns of known and novel small RNAs in human cervical cancer"
Cancer Res. 67:6031-6043(2007).
|