Stem-loop sequence osa-MIR531a

AccessionMI0003204 (change log)
Previous IDsosa-MIR531
DescriptionOryza sativa miR531 stem-loop
Gene family MIPF0000607; MIR531
Literature search

8 open access papers mention osa-MIR531a
(15 sentences)

Stem-loop
          c     cu      c     c        -  c 
5' ggcgccg cgagc  ugcucg cgggg ugcgugcc gc a
   ||||||| |||||  |||||| ||||| |||||||| ||  
3' ccguggc gcucg  gcgagc gcccc acgcgcgg cg u
          a     uu      u     u        u  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr8: 1220358-1220438 [-]
intergenic
Database links

Mature sequence osa-miR531a

Accession MIMAT0002887
Previous IDsosa-miR531
Sequence

18 - 

cucgccggggcugcgugccgccau

 - 41

Get sequence
Evidence experimental; Northern [1]

References

1
PMID:16126864 "Loss of function of OsDCL1 affects microRNA accumulation and causes developmental defects in rice" Liu B, Li P, Li X, Liu C, Cao S, Chu C, Cao X Plant Physiol. 139:296-305(2005).