Stem-loop sequence osa-MIR529a

AccessionMI0003202 (change log)
Previous IDsosa-MIR529
DescriptionOryza sativa miR529a stem-loop
Gene family MIPF0000388; MIR529
Literature search

21 open access papers mention osa-MIR529a
(62 sentences)

Stem-loop
                a          agu     --ucacauau    au u 
5' gaagaagagagag guacagccuu   ucaga          gacu  c u
   ||||||||||||| ||||||||||   |||||          ||||  |  
3' cuucuucucucuc caugucggaa   agucu          cuga  g u
                c          -gu     cauagcuagu    gc u 
Get sequence
Deep sequencing
485 reads, 250 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr2: 16227805-16227903 [+]
intergenic
Database links

Mature sequence osa-miR529a

Accession MIMAT0002885
Previous IDsosa-miR529
Sequence

80 - 

cuguacccucucucuucuuc

 - 99

Get sequence
Deep sequencing6 reads, 2 experiments
Evidence experimental; Northern [1]
Database links

References

1
PMID:16126864 "Loss of function of OsDCL1 affects microRNA accumulation and causes developmental defects in rice" Liu B, Li P, Li X, Liu C, Cao S, Chu C, Cao X Plant Physiol. 139:296-305(2005).