Stem-loop sequence osa-MIR528

AccessionMI0003201 (change log)
DescriptionOryza sativa miR528 stem-loop
Gene family MIPF0000868; MIR528
Literature search

38 open access papers mention osa-MIR528
(197 sentences)

Stem-loop
                u   g     ca     uu   -uu     c 
5' aguggaaggggca gca aggag  ggaga  cag   ugaag u
   ||||||||||||| ||| |||||  |||||  |||   ||||| g
3' uuaccuucuccgu cgu uccuc  ucucu  guu   acuuc g
                u   g     --     cc   uuc     a 
Get sequence
Deep sequencing
7015 reads, 4.55e+03 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr3: 1667328-1667415 [+]
intergenic
Database links

Mature sequence osa-miR528-5p

Accession MIMAT0002884
Previous IDsosa-miR528
Sequence

3 - 

uggaaggggcaugcagaggag

 - 23

Get sequence
Deep sequencing7013 reads, 2 experiments
Evidence experimental; Northern [1]
Database links

Mature sequence osa-miR528-3p

Accession MIMAT0022926
Sequence

68 - 

ccugugcuugccucuuccauu

 - 88

Get sequence
Deep sequencing2 reads, 1 experiments
Evidence experimental; Illumina [2]

References

1
PMID:16126864 "Loss of function of OsDCL1 affects microRNA accumulation and causes developmental defects in rice" Liu B, Li P, Li X, Liu C, Cao S, Chu C, Cao X Plant Physiol. 139:296-305(2005).
2
PMID:21901091 "Viral infection induces expression of novel phased microRNAs from conserved cellular microRNA precursors" Du P, Wu J, Zhang J, Zhao S, Zheng H, Gao G, Wei L, Li Y PLoS Pathog. 7:e1002176(2011).