Stem-loop sequence hsa-mir-514a-1

AccessionMI0003198 (change log)
Previous IDshsa-mir-514-1
Symbol HGNC:MIR514A1
DescriptionHomo sapiens miR-514a-1 stem-loop
Gene family MIPF0000130; mir-506
Literature search

9 open access papers mention hsa-mir-514a-1
(60 sentences)

Stem-loop
   aac    u   -    g   c      -    g    a      u  aua 
5'    augu guc ugug uac cuacuc ugga agug caauca gu   a
      |||| ||| |||| ||| |||||| |||| |||| |||||| ||    
3'    ugca cag acgc aug gaugag gucu ucac guuagu ua   u
   gca    -   u    a   a      u    -    a      u  aau 
Get sequence
Deep sequencing
206968 reads, 431 reads per million, 115 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chrX: 147279247-147279344 [-]
intergenic
Clustered miRNAs
< 10kb from hsa-mir-514a-1
hsa-mir-514a-3chrX: 147284641-147284728 [-]
hsa-mir-514a-2chrX: 147281943-147282030 [-]
hsa-mir-514a-1chrX: 147279247-147279344 [-]
hsa-mir-510chrX: 147272335-147272408 [-]
Database links

Mature sequence hsa-miR-514a-5p

Accession MIMAT0022702
Sequence

22 - 

uacucuggagagugacaaucaug

 - 44

Get sequence
Deep sequencing16176 reads, 81 experiments
Evidence not experimental
Database links
Predicted targets

Mature sequence hsa-miR-514a-3p

Accession MIMAT0002883
Previous IDshsa-miR-514
Sequence

59 - 

auugacacuucugugaguaga

 - 79

Get sequence
Deep sequencing604578 reads, 91 experiments
Evidence experimental; array-cloned [1], cloned [2]
Database links
Predicted targets

References

1
PMID:15965474 "Identification of hundreds of conserved and nonconserved human microRNAs" Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z Nat Genet. 37:766-770(2005).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).