|
miRBase |
|
Stem-loop sequence hsa-mir-514a-1 |
||||||||||
| Accession | MI0003198 | |||||||||
| Previous IDs | hsa-mir-514-1 | |||||||||
| Symbol | HGNC:MIR514-1 | |||||||||
| Description | Homo sapiens miR-514a-1 stem-loop | |||||||||
| Gene family | MIPF0000130; mir-506 | |||||||||
| Stem-loop |
aac u - g c - g a u aua augu guc ugug uac cuacuc ugga agug caauca gu a |||| ||| |||| ||| |||||| |||| |||| |||||| || ugca cag acgc aug gaugag gucu ucac guuagu ua u gca - u a a u - a u aau |
|||||||||
| Deep sequencing |
| |||||||||
| Comments |
The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. |
|||||||||
| Genome context |
|
|||||||||
| Clustered miRNAs |
|
|||||||||
| Database links | ||||||||||
Mature sequence hsa-miR-514a-5p |
|
| Accession | MIMAT0022702 |
| Sequence |
22 - uacucuggagagugacaaucaug - 44 |
| Deep sequencing | 3368 reads, 16 experiments |
| Evidence | not experimental |
| Predicted targets |
|
Mature sequence hsa-miR-514a-3p |
|
| Accession | MIMAT0002883 |
| Previous IDs | hsa-miR-514 |
| Sequence |
59 - auugacacuucugugaguaga - 79 |
| Deep sequencing | 4665 reads, 11 experiments |
| Evidence | experimental; array-cloned [1], cloned [2] |
| Predicted targets |
|
References |
|
| 1 |
PMID:15965474
"Identification of hundreds of conserved and nonconserved human microRNAs"
Nat Genet. 37:766-770(2005).
|
| 2 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|