Stem-loop sequence hsa-mir-510

AccessionMI0003197 (change log)
Symbol HGNC:MIR510
DescriptionHomo sapiens miR-510 stem-loop
Gene family MIPF0000130; mir-506
Literature search

15 open access papers mention hsa-mir-510
(142 sentences)

Stem-loop
      g  uc      -a    a  gg         g a 
5' gug ug  cuacuc  ggag gu  caaucacau u a
   ||| ||  ||||||  |||| ||  ||||||||| |  
3' cac au  ggugag  ucuc ca  guuagugug a u
      a  ga      aa    -  aa         g u 
Get sequence
Deep sequencing
1759 reads, 20.4 reads per million, 49 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chrX: 147272335-147272408 [-]
intergenic
Clustered miRNAs
< 10kb from hsa-mir-510
hsa-mir-514a-2chrX: 147281943-147282030 [-]
hsa-mir-514a-1chrX: 147279247-147279344 [-]
hsa-mir-510chrX: 147272335-147272408 [-]
Database links

Mature sequence hsa-miR-510-5p

Accession MIMAT0002882
Sequence

10 - 

uacucaggagaguggcaaucac

 - 31

Get sequence
Deep sequencing1275 reads, 44 experiments
Evidence experimental; array-cloned [1], cloned [2], Illumina [3]
Database links
Predicted targets

Mature sequence hsa-miR-510-3p

Accession MIMAT0026613
Sequence

47 - 

auugaaaccucuaagagugga

 - 67

Get sequence
Deep sequencing481 reads, 17 experiments
Evidence experimental; Illumina [3]
Database links
Predicted targets

References

1
PMID:15965474 "Identification of hundreds of conserved and nonconserved human microRNAs" Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z Nat Genet. 37:766-770(2005).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).