Stem-loop sequence hsa-mir-510

Accession MI0003197
Symbol HGNC:MIR510
Description Homo sapiens miR-510 stem-loop
Gene family MIPF0000130; mir-506
Stem-loop 
   g  uc      -a    a  gg         g a 
gug ug  cuacuc  ggag gu  caaucacau u a
||| ||  ||||||  |||| ||  ||||||||| |  
cac au  ggugag  ucuc ca  guuagugug a u
   a  ga      aa    -  aa         g u
Get sequence
Deep sequencing
359 reads, 10 experiments
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chrX: 146353853-146353926 [-]
intergenic
Clustered miRNAs
< 10kb from hsa-mir-510
hsa-mir-514a-2 chrX: 146363461-146363548 [-]
hsa-mir-514a-1 chrX: 146360765-146360862 [-]
hsa-mir-510 chrX: 146353853-146353926 [-]
Database links

Mature sequence hsa-miR-510

Accession MIMAT0002882
Sequence

10 -  

uacucaggagaguggcaaucac

 - 31

Get sequence
Deep sequencing 343 reads, 10 experiments
Evidence experimental; array-cloned [1], cloned [2]
Validated targets
Predicted targets

References

1
PMID:15965474 "Identification of hundreds of conserved and nonconserved human microRNAs" Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z Nat Genet. 37:766-770(2005).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).