Stem-loop sequence hsa-mir-508

AccessionMI0003195 (change log)
Symbol HGNC:MIR508
DescriptionHomo sapiens miR-508 stem-loop
Gene family MIPF0000130; mir-506
Stem-loop
        --uuca  ------   -     g   c              gu  c      aaa 
5' ccacc      gc      uga gugua ugc cuacuccagagggc  ca ucaugu   c
   |||||      ||      ||| ||||| ||| ||||||||||||||  || ||||||    
3' ggugg      cg      acu cacau aug gaugagguuuuccg  gu aguaca   u
        uuuaua  caaugc   a     a   a              au  u      aaa 
Get sequence
Deep sequencing
27539 reads, 292 reads per million, 37 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chrX: 147236913-147237027 [-]
intergenic
Clustered miRNAs
< 10kb from hsa-mir-508
hsa-mir-508chrX: 147236913-147237027 [-]
hsa-mir-507chrX: 147230984-147231077 [-]
hsa-mir-506chrX: 147230720-147230843 [-]
Database links

Mature sequence hsa-miR-508-5p

Accession MIMAT0004778
Sequence

26 - 

uacuccagagggcgucacucaug

 - 48

Get sequence
Deep sequencing4840 reads, 25 experiments
Evidence experimental; cloned [2]
Database links
Predicted targets

Mature sequence hsa-miR-508-3p

Accession MIMAT0002880
Previous IDshsa-miR-508
Sequence

61 - 

ugauuguagccuuuuggaguaga

 - 83

Get sequence
Deep sequencing22698 reads, 29 experiments
Evidence experimental; array-cloned [1], cloned [2]
Database links
Predicted targets

References

1
PMID:15965474 "Identification of hundreds of conserved and nonconserved human microRNAs" Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z Nat Genet. 37:766-770(2005).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).