Stem-loop sequence hsa-mir-507

AccessionMI0003194 (change log)
Symbol HGNC:MIR507
DescriptionHomo sapiens miR-507 stem-loop
Gene family MIPF0000130; mir-506
Stem-loop
      -    -     g  c            a    cau      guc 
5' gug cugu gugua ug uucacuucaaga gugc   gcaugu   u
   ||| |||| ||||| || |||||||||||| ||||   ||||||    
3' cau gaca cacgu au aagugagguuuu cacg   uguaua   a
      a    a     a  a            c    uuu      aag 
Get sequence
Deep sequencing
65 reads, 22.2 reads per million, 18 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chrX: 147230984-147231077 [-]
intergenic
Clustered miRNAs
< 10kb from hsa-mir-507
hsa-mir-508chrX: 147236913-147237027 [-]
hsa-mir-507chrX: 147230984-147231077 [-]
hsa-mir-506chrX: 147230720-147230843 [-]
hsa-mir-513a-2chrX: 147225826-147225952 [-]
Database links

Mature sequence hsa-miR-507

Accession MIMAT0002879
Sequence

56 - 

uuuugcaccuuuuggagugaa

 - 76

Get sequence
Deep sequencing63 reads, 16 experiments
Evidence experimental; array-cloned [1], cloned [2]
Database links
Predicted targets

References

1
PMID:15965474 "Identification of hundreds of conserved and nonconserved human microRNAs" Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z Nat Genet. 37:766-770(2005).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).