Stem-loop sequence hsa-mir-506

AccessionMI0003193 (change log)
Symbol HGNC:MIR506
DescriptionHomo sapiens miR-506 stem-loop
Gene family MIPF0000130; mir-506
Literature search

61 open access papers mention hsa-mir-506
(334 sentences)

Stem-loop
           ---caucag    acua  ug  g   c          a     ua    a     u 
5' gccaccac         ccau    ug  ua ugc uuauucagga ggugu  cuua uagau a
   ||||||||         ||||    ||  || ||| |||||||||| |||||  |||| |||||  
3' cgguggug         ggua    ac  gu aug gaugagucuu ccacg  gaau guuua a
           uuuacaaca    --ca  gu  a   a          c     --    -     u 
Get sequence
Deep sequencing
13734 reads, 55.6 reads per million, 54 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chrX: 147230720-147230843 [-]
intergenic
Clustered miRNAs
< 10kb from hsa-mir-506
hsa-mir-508chrX: 147236913-147237027 [-]
hsa-mir-507chrX: 147230984-147231077 [-]
hsa-mir-506chrX: 147230720-147230843 [-]
hsa-mir-513a-2chrX: 147225826-147225952 [-]
Database links

Mature sequence hsa-miR-506-5p

Accession MIMAT0022701
Sequence

35 - 

uauucaggaagguguuacuuaa

 - 56

Get sequence
Deep sequencing830 reads, 25 experiments
Evidence not experimental
Database links
Predicted targets

Mature sequence hsa-miR-506-3p

Accession MIMAT0002878
Previous IDshsa-miR-506
Sequence

71 - 

uaaggcacccuucugaguaga

 - 91

Get sequence
Deep sequencing12894 reads, 47 experiments
Evidence experimental; array-cloned [1]
Database links
Predicted targets

References

1
PMID:15965474 "Identification of hundreds of conserved and nonconserved human microRNAs" Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z Nat Genet. 37:766-770(2005).