Stem-loop sequence hsa-mir-513a-2

AccessionMI0003192 (change log)
Previous IDshsa-mir-513-2
Symbol HGNC:MIR513A2
DescriptionHomo sapiens miR-513a-2 stem-loop
Gene family MIPF0000130; mir-506
Literature search

46 open access papers mention hsa-mir-513a-2
(290 sentences)

Stem-loop
              --u   -c   u ag      g        a   gg     uc        gaa 
5' ggaugccacau   cag  cau c  ugugca ugccuuuc cag  aggug  auuuaugu   c
   |||||||||||   |||  ||| |  |||||| |||||||| |||  |||||  ||||||||    
3' ccuguggugua   guc  gua g  acaugu augggaag guc  uccac  uaaauaua   u
              uac   ac   c --      a        a   uu     uu        aaa 
Get sequence
Deep sequencing
4314 reads, 20.5 reads per million, 73 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chrX: 147225826-147225952 [-]
intergenic
Clustered miRNAs
< 10kb from hsa-mir-513a-2
hsa-mir-507chrX: 147230984-147231077 [-]
hsa-mir-506chrX: 147230720-147230843 [-]
hsa-mir-513a-2chrX: 147225826-147225952 [-]
Database links

Mature sequence hsa-miR-513a-5p

Accession MIMAT0002877
Previous IDshsa-miR-513;hsa-miR-513-5p
Sequence

36 - 

uucacagggaggugucau

 - 53

Get sequence
Deep sequencing5754 reads, 64 experiments
Evidence experimental; array-cloned [1], cloned [2]
Database links
Predicted targets

Mature sequence hsa-miR-513a-3p

Accession MIMAT0004777
Previous IDshsa-miR-513-3p
Sequence

71 - 

uaaauuucaccuuucugagaagg

 - 93

Get sequence
Deep sequencing2846 reads, 32 experiments
Evidence experimental; cloned [2]
Database links
Predicted targets

References

1
PMID:15965474 "Identification of hundreds of conserved and nonconserved human microRNAs" Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z Nat Genet. 37:766-770(2005).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).