Stem-loop sequence hsa-mir-513a-2

Accession MI0003192
Previous IDs hsa-mir-513-2
Symbol HGNC:MIR513A2
Description Homo sapiens miR-513a-2 stem-loop
Gene family MIPF0000130; mir-506
Stem-loop 
           --u   -c   u ag      g        a   gg     uc        gaa 
ggaugccacau   cag  cau c  ugugca ugccuuuc cag  aggug  auuuaugu   c
|||||||||||   |||  ||| |  |||||| |||||||| |||  |||||  ||||||||    
ccuguggugua   guc  gua g  acaugu augggaag guc  uccac  uaaauaua   u
           uac   ac   c --      a        a   uu     uu        aaa
Get sequence
Deep sequencing
1637 reads, 12 experiments
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chrX: 146307344-146307470 [-]
intergenic
Clustered miRNAs
< 10kb from hsa-mir-513a-2
hsa-mir-507 chrX: 146312502-146312595 [-]
hsa-mir-506 chrX: 146312238-146312361 [-]
hsa-mir-513a-2 chrX: 146307344-146307470 [-]
Database links

Mature sequence hsa-miR-513a-5p

Accession MIMAT0002877
Previous IDs hsa-miR-513;hsa-miR-513-5p
Sequence

36 -  

uucacagggaggugucau

 - 53

Get sequence
Deep sequencing 2436 reads, 12 experiments
Evidence experimental; array-cloned [1], cloned [2]
Validated targets
Predicted targets

Mature sequence hsa-miR-513a-3p

Accession MIMAT0004777
Previous IDs hsa-miR-513-3p
Sequence

71 -  

uaaauuucaccuuucugagaagg

 - 93

Get sequence
Deep sequencing 838 reads, 6 experiments
Evidence experimental; cloned [2]
Predicted targets

References

1
PMID:15965474 "Identification of hundreds of conserved and nonconserved human microRNAs" Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z Nat Genet. 37:766-770(2005).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).