|
miRBase |
|
Stem-loop sequence hsa-mir-513a-2 |
||||||||
| Accession | MI0003192 | |||||||
| Previous IDs | hsa-mir-513-2 | |||||||
| Symbol | HGNC:MIR513A2 | |||||||
| Description | Homo sapiens miR-513a-2 stem-loop | |||||||
| Gene family | MIPF0000130; mir-506 | |||||||
| Stem-loop |
--u -c u ag g a gg uc gaa ggaugccacau cag cau c ugugca ugccuuuc cag aggug auuuaugu c ||||||||||| ||| ||| | |||||| |||||||| ||| ||||| |||||||| ccuguggugua guc gua g acaugu augggaag guc uccac uaaauaua u uac ac c -- a a uu uu aaa |
|||||||
| Deep sequencing |
| |||||||
| Comments |
The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. |
|||||||
| Genome context |
|
|||||||
| Clustered miRNAs |
|
|||||||
| Database links | ||||||||
Mature sequence hsa-miR-513a-5p |
|
| Accession | MIMAT0002877 |
| Previous IDs | hsa-miR-513;hsa-miR-513-5p |
| Sequence |
36 - uucacagggaggugucau - 53 |
| Deep sequencing | 2436 reads, 12 experiments |
| Evidence | experimental; array-cloned [1], cloned [2] |
| Validated targets |
|
| Predicted targets |
|
Mature sequence hsa-miR-513a-3p |
|
| Accession | MIMAT0004777 |
| Previous IDs | hsa-miR-513-3p |
| Sequence |
71 - uaaauuucaccuuucugagaagg - 93 |
| Deep sequencing | 838 reads, 6 experiments |
| Evidence | experimental; cloned [2] |
| Predicted targets |
|
References |
|
| 1 |
PMID:15965474
"Identification of hundreds of conserved and nonconserved human microRNAs"
Nat Genet. 37:766-770(2005).
|
| 2 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|