Stem-loop sequence hsa-mir-513a-1

AccessionMI0003191 (change log)
Previous IDshsa-mir-513-1
Symbol HGNC:MIR513A1
DescriptionHomo sapiens miR-513a-1 stem-loop
Gene family MIPF0000130; mir-506
Literature search

46 open access papers mention hsa-mir-513a-1
(291 sentences)

Stem-loop
               uca  cauu  -  -     g        a   gg     uc        gaa 
5' gggaugccacau   gc    ca gc guaca ugccuuuc cag  aggug  auuuaugu   c
   ||||||||||||   ||    || || ||||| |||||||| |||  |||||  ||||||||    
3' cccuguggugua   cg    gu cg caugu augggaag guc  uccac  uaaauaua   u
               -ua  ucac  a  a     a        a   uu     uu        aaa 
Get sequence
Deep sequencing
4326 reads, 23.3 reads per million, 73 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chrX: 147213463-147213591 [-]
intergenic
Database links

Mature sequence hsa-miR-513a-5p

Accession MIMAT0002877
Previous IDshsa-miR-513;hsa-miR-513-5p
Sequence

37 - 

uucacagggaggugucau

 - 54

Get sequence
Deep sequencing5754 reads, 64 experiments
Evidence experimental; array-cloned [1], cloned [2]
Database links
Predicted targets

Mature sequence hsa-miR-513a-3p

Accession MIMAT0004777
Previous IDshsa-miR-513-3p
Sequence

72 - 

uaaauuucaccuuucugagaagg

 - 94

Get sequence
Deep sequencing2846 reads, 32 experiments
Evidence experimental; cloned [2]
Database links
Predicted targets

References

1
PMID:15965474 "Identification of hundreds of conserved and nonconserved human microRNAs" Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z Nat Genet. 37:766-770(2005).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).