Stem-loop sequence hsa-mir-505

Accession MI0003190
Symbol HGNC:MIR505
Description Homo sapiens miR-505 stem-loop
Gene family MIPF0000217; mir-505
Stem-loop 
     ac    u           g    a        ucug 
gaugc  ccag gggggagccag aagu uugauguu    c
|||||  |||| ||||||||||| |||| ||||||||    c
cuacg  gguc cuccuuugguc uuca aacugcga    a
     -a    u           g    c        uuug
Get sequence
Deep sequencing
1123 reads, 30 experiments
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The 5' end of the miRNA may be offset with respect to previous annotations.

Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chrX: 139006307-139006390 [-]
sense
OTTHUMT00000058566 ; ATP11C-001; intron 1
OTTHUMT00000058570 ; ATP11C-005; intron 1
OTTHUMT00000058566 ; ATP11C-001; intron 1
OTTHUMT00000058570 ; ATP11C-005; intron 1
OTTHUMT00000058566 ; ATP11C-001; intron 1
OTTHUMT00000058570 ; ATP11C-005; intron 1
ENST00000370557 ; ATP11C-001; intron 1
ENST00000485626 ; ATP11C-005; intron 1
ENST00000370557 ; ATP11C-001; intron 1
ENST00000485626 ; ATP11C-005; intron 1
ENST00000370557 ; ATP11C-001; intron 1
ENST00000485626 ; ATP11C-005; intron 1
Database links

Mature sequence hsa-miR-505-5p

Accession MIMAT0004776
Previous IDs hsa-miR-505*
Sequence

15 -  

gggagccaggaaguauugaugu

 - 36

Get sequence
Deep sequencing 345 reads, 24 experiments
Evidence experimental; cloned [2]
Predicted targets

Mature sequence hsa-miR-505-3p

Accession MIMAT0002876
Previous IDs hsa-miR-505
Sequence

51 -  

cgucaacacuugcugguuuccu

 - 72

Get sequence
Deep sequencing 777 reads, 24 experiments
Evidence experimental; array-cloned [1], cloned [2-3]
Validated targets
Predicted targets

References

1
PMID:15965474 "Identification of hundreds of conserved and nonconserved human microRNAs" Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z Nat Genet. 37:766-770(2005).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).