Stem-loop sequence hsa-mir-505

AccessionMI0003190 (change log)
Symbol HGNC:MIR505
DescriptionHomo sapiens miR-505 stem-loop
Gene family MIPF0000217; mir-505
Literature search

33 open access papers mention hsa-mir-505
(194 sentences)

Stem-loop
        ac    u           g    a        ucug 
5' gaugc  ccag gggggagccag aagu uugauguu    c
   |||||  |||| ||||||||||| |||| ||||||||    c
3' cuacg  gguc cuccuuugguc uuca aacugcga    a
        -a    u           g    c        uuug 
Get sequence
Deep sequencing
36041 reads, 86.2 reads per million, 159 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The 5' end of the miRNA may be offset with respect to previous annotations.

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chrX: 139924148-139924231 [-]
intergenic
Database links

Mature sequence hsa-miR-505-5p

Accession MIMAT0004776
Previous IDshsa-miR-505*
Sequence

15 - 

gggagccaggaaguauugaugu

 - 36

Get sequence
Deep sequencing7165 reads, 154 experiments
Evidence experimental; cloned [2]
Database links
Predicted targets

Mature sequence hsa-miR-505-3p

Accession MIMAT0002876
Previous IDshsa-miR-505
Sequence

51 - 

cgucaacacuugcugguuuccu

 - 72

Get sequence
Deep sequencing28861 reads, 158 experiments
Evidence experimental; array-cloned [1], cloned [2-3]
Database links
Predicted targets

References

1
PMID:15965474 "Identification of hundreds of conserved and nonconserved human microRNAs" Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z Nat Genet. 37:766-770(2005).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).