Stem-loop sequence hsa-mir-504

AccessionMI0003189 (change log)
Symbol HGNC:MIR504
DescriptionHomo sapiens miR-504 stem-loop
Gene family MIPF0000437; mir-504
Literature search

27 open access papers mention hsa-mir-504
(170 sentences)

Stem-loop
      -g    -            g          -a  u   u 
5' gcu  cugu ugggagacccug ucugcacucu  uc gua u
   |||  |||| |||||||||||| ||||||||||  || |||  
3' cgg  gaca acccuuugggac ggacgugagg  ag cau c
      ga    u            g          ga  u   u 
Get sequence
Deep sequencing
14733 reads, 4.07 reads per million, 123 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chrX: 138667711-138667793 [-]
sense
OTTHUMT00000058564 ; MCF2-006; intron 11
OTTHUMT00000058563 ; MCF2-005; intron 14
OTTHUMT00000058561 ; MCF2-003; intron 22
OTTHUMT00000058560 ; MCF2-002; intron 23
OTTHUMT00000058562 ; MCF2-004; intron 24
OTTHUMT00000058559 ; MCF2-001; intron 26
OTTHUMT00000377602 ; MCF2-008; intron 27
ENST00000437564 ; MCF2-006; intron 11
ENST00000446225 ; MCF2-005; intron 14
ENST00000536274 ; MCF2-203; intron 21
ENST00000370573 ; MCF2-003; intron 22
ENST00000370576 ; MCF2-002; intron 23
ENST00000338585 ; MCF2-004; intron 24
ENST00000520602 ; MCF2-001; intron 26
ENST00000370578 ; MCF2-201; intron 26
ENST00000414978 ; MCF2-202; intron 26
ENST00000519895 ; MCF2-008; intron 27
Database links

Mature sequence hsa-miR-504-5p

Accession MIMAT0002875
Sequence

13 - 

agacccuggucugcacucuauc

 - 34

Get sequence
Deep sequencing14589 reads, 122 experiments
Evidence experimental; array-cloned [1], cloned [2], Illumina [3]
Database links
Predicted targets

Mature sequence hsa-miR-504-3p

Accession MIMAT0026612
Sequence

50 - 

gggagugcagggcaggguuuc

 - 70

Get sequence
Deep sequencing129 reads, 52 experiments
Evidence experimental; Illumina [3]
Predicted targets

References

1
PMID:15965474 "Identification of hundreds of conserved and nonconserved human microRNAs" Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z Nat Genet. 37:766-770(2005).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).