Stem-loop sequence hsa-mir-504

Accession

MI0003189

Symbol

HGNC:MIR504

Description

Homo sapiens miR-504 stem-loop

Gene family

MIPF0000437; mir-504

Stem-loop

   -g    -            g          -a  u   u 
gcu  cugu ugggagacccug ucugcacucu  uc gua u
|||  |||| |||||||||||| ||||||||||  || |||  
cgg  gaca acccuuugggac ggacgugagg  ag cau c
   ga    u            g          ga  u   u 

Deep sequencing

145 reads, 15 experiments

Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context

• Coordinates (GRCh37.p5): chrX: 137749872-137749954 [-]
• Overlapping transcripts:

  sense

  OTTHUMT00000058534 ; FGF13-001; intron 3

  OTTHUMT00000058535 ; FGF13-002; intron 3

  OTTHUMT00000058534 ; FGF13-001; intron 3

  OTTHUMT00000058535 ; FGF13-002; intron 3

  OTTHUMT00000058534 ; FGF13-001; intron 3

  OTTHUMT00000058535 ; FGF13-002; intron 3

  OTTHUMT00000058536 ; FGF13-003; intron 5

  OTTHUMT00000058538 ; FGF13-005; intron 5

  OTTHUMT00000058536 ; FGF13-003; intron 5

  OTTHUMT00000058538 ; FGF13-005; intron 5

  OTTHUMT00000058536 ; FGF13-003; intron 5

  OTTHUMT00000058538 ; FGF13-005; intron 5

  ENST00000315930 ; FGF13-001; intron 3

  ENST00000305414 ; FGF13-002; intron 3

  ENST00000541469 ; FGF13-203; intron 3

  ENST00000441825 ; FGF13-202; intron 3

  ENST00000315930 ; FGF13-001; intron 3

  ENST00000305414 ; FGF13-002; intron 3

  ENST00000541469 ; FGF13-203; intron 3

  ENST00000441825 ; FGF13-202; intron 3

  ENST00000315930 ; FGF13-001; intron 3

  ENST00000305414 ; FGF13-002; intron 3

  ENST00000541469 ; FGF13-203; intron 3

  ENST00000441825 ; FGF13-202; intron 3

  ENST00000370603 ; FGF13-201; intron 4

  ENST00000370603 ; FGF13-201; intron 4

  ENST00000370603 ; FGF13-201; intron 4

  ENST00000436198 ; FGF13-003; intron 5

  ENST00000455663 ; FGF13-005; intron 5

  ENST00000436198 ; FGF13-003; intron 5

  ENST00000455663 ; FGF13-005; intron 5

  ENST00000436198 ; FGF13-003; intron 5

  ENST00000455663 ; FGF13-005; intron 5

Database links

• EMBL: AY882272;AY882272
• ENTREZGENE: 574507;MIR504
• HGNC: 32139;MIR504

Mature sequence hsa-miR-504

• Accession: MIMAT0002875
• Sequence: 13 - agacccuggucugcacucuauc - 34
• Deep sequencing: 132 reads, 15 experiments
• Evidence: experimental; array-cloned [1], cloned [2]
• Validated targets:
  • MIRECORDS:hsa-miR-504
  • MIRTARBASE:hsa-miR-504
  • TARBASE:hsa-miR-504
• Predicted targets:
  • DIANA-MICROT:hsa-miR-504
  • MICRORNA.ORG:hsa-miR-504
  • MIRDB:hsa-miR-504
  • RNA22-HSA:hsa-miR-504
  • TARGETMINER:hsa-miR-504
  • TARGETSCAN-VERT:hsa-miR-504

References

1. PMID:15965474 "Identification of hundreds of conserved and nonconserved human microRNAs" Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z Nat Genet. 37:766-770(2005).
2. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).