|
miRBase |
|
Stem-loop sequence hsa-mir-503 |
|||||
| Accession | MI0003188 | ||||
| Symbol | HGNC:MIR503 | ||||
| Description | Homo sapiens miR-503 stem-loop | ||||
| Gene family | MIPF0000183; mir-503 | ||||
| Stem-loop |
a u g gu a ugcccu gcagcgggaacagu cu ca gagcg u |||||| |||||||||||||| || || ||||| c auggga cgucgccuuuguua gg gu cucgu g c u g -- g |
||||
| Deep sequencing |
| ||||
| Genome context |
|
||||
| Clustered miRNAs | |||||
| Database links | |||||
Mature sequence hsa-miR-503-5p |
|
| Accession | MIMAT0002874 |
| Previous IDs | hsa-miR-503 |
| Sequence |
6 - uagcagcgggaacaguucugcag - 28 |
| Deep sequencing | 9093 reads, 29 experiments |
| Evidence | experimental; array-cloned [1], cloned [2-3], SOLiD [4] |
| Validated targets |
|
| Predicted targets |
|
Mature sequence hsa-miR-503-3p |
|
| Accession | MIMAT0022925 |
| Sequence |
46 - gggguauuguuuccgcugccagg - 68 |
| Deep sequencing | 24 reads, 4 experiments |
| Evidence | experimental; SOLiD [4] |
References |
|
| 1 |
PMID:15965474
"Identification of hundreds of conserved and nonconserved human microRNAs"
Nat Genet. 37:766-770(2005).
|
| 2 |
PMID:16274478
"Identification of clustered microRNAs using an ab initio prediction method"
BMC Bioinformatics. 6:267(2005).
|
| 3 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
| 4 | |