Stem-loop sequence hsa-mir-503

AccessionMI0003188 (change log)
Symbol HGNC:MIR503
DescriptionHomo sapiens miR-503 stem-loop
Gene family MIPF0000183; mir-503
Literature search

113 open access papers mention hsa-mir-503
(873 sentences)

Stem-loop
         a              u  g  gu     a 
5' ugcccu gcagcgggaacagu cu ca  gagcg u
   |||||| |||||||||||||| || ||  ||||| c
3' auggga cgucgccuuuguua gg gu  cucgu g
         c              u  g  --     g 
Get sequence
Deep sequencing
60761 reads, 133 reads per million, 156 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chrX: 134546328-134546398 [-]
intergenic
Clustered miRNAs
< 10kb from hsa-mir-503
hsa-mir-424chrX: 134546614-134546711 [-]
hsa-mir-503chrX: 134546328-134546398 [-]
hsa-mir-542chrX: 134541341-134541437 [-]
hsa-mir-450a-2chrX: 134540508-134540607 [-]
hsa-mir-450a-1chrX: 134540341-134540431 [-]
hsa-mir-450bchrX: 134540185-134540262 [-]
Database links

Mature sequence hsa-miR-503-5p

Accession MIMAT0002874
Previous IDshsa-miR-503
Sequence

6 - 

uagcagcgggaacaguucugcag

 - 28

Get sequence
Deep sequencing59540 reads, 156 experiments
Evidence experimental; array-cloned [1], cloned [2-3], SOLiD [4]
Database links
Predicted targets

Mature sequence hsa-miR-503-3p

Accession MIMAT0022925
Sequence

46 - 

gggguauuguuuccgcugccagg

 - 68

Get sequence
Deep sequencing1196 reads, 48 experiments
Evidence experimental; SOLiD [4]
Database links
Predicted targets

References

1
PMID:15965474 "Identification of hundreds of conserved and nonconserved human microRNAs" Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z Nat Genet. 37:766-770(2005).
2
PMID:16274478 "Identification of clustered microRNAs using an ab initio prediction method" Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M BMC Bioinformatics. 6:267(2005).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:22282338 "Deep-sequencing of endothelial cells exposed to hypoxia reveals the complexity of known and novel microRNAs" Voellenkle C, Rooij Jv, Guffanti A, Brini E, Fasanaro P, Isaia E, Croft L, David M, Capogrossi MC, Moles A, Felsani A, Martelli F RNA. 18:472-484(2012).