Stem-loop sequence hsa-mir-450a-2

Accession

MI0003187

Previous IDs

hsa-mir-450-2

Symbol

HGNC:MIR450A2

Description

Homo sapiens miR-450a-2 stem-loop

Gene family

MIPF0000128; mir-450

Stem-loop

-ccaaagaaa     u       uuu     u               aa 
          gaugc aaacuau   ugcga guguuccuaauaugu  u
          ||||| |||||||   ||||| |||||||||||||||  a
          cuaug uuugaua   acguu uacagggguuaugua  u
gguauaauaa     u       cuu     u               aa 

Deep sequencing

323 reads, 31 experiments

Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4]. The 5' end of the miRNA may be offset with respect to previous annotations.

Genome context

• Coordinates (GRCh37.p5): chrX: 133674538-133674637 [-]
• Overlapping transcripts:

  intergenic

Clustered miRNAs

< 10kb from hsa-mir-450a-2

• hsa-mir-424: chrX: 133680644-133680741 [-]
• hsa-mir-503: chrX: 133680358-133680428 [-]
• hsa-mir-542: chrX: 133675371-133675467 [-]
• hsa-mir-450a-2: chrX: 133674538-133674637 [-]
• hsa-mir-450a-1: chrX: 133674371-133674461 [-]
• hsa-mir-450b: chrX: 133674215-133674292 [-]

Database links

• ENTREZGENE: 574505;MIR450A2
• HGNC: 32137;MIR450A2

Mature sequence hsa-miR-450a-5p

• Accession: MIMAT0001545
• Previous IDs: hsa-miR-450;hsa-miR-450a
• Sequence: 23 - uuuugcgauguguuccuaauau - 44
• Deep sequencing: 468 reads, 30 experiments
• Evidence: experimental; array-cloned [1,3], cloned [1,4]
• Validated targets:
  • TARBASE:hsa-miR-450a-5p
• Predicted targets:
  • DIANA-MICROT:hsa-miR-450a-5p
  • MICRORNA.ORG:hsa-miR-450a-5p
  • MIRDB:hsa-miR-450a-5p
  • RNA22-HSA:hsa-miR-450a-5p
  • TARGETMINER:hsa-miR-450a-5p
  • TARGETSCAN-VERT:hsa-miR-450a

Mature sequence hsa-miR-450a-3p

• Accession: MIMAT0022700
• Sequence: 58 - auuggggacauuuugcauucau - 79
• Deep sequencing: 91 reads, 10 experiments
• Evidence: not experimental
• Predicted targets:
  • DIANA-MICROT:hsa-miR-450a-3p
  • MIRDB:hsa-miR-450a-3p
  • TARGETMINER:hsa-miR-450a-3p

References

1. PMID:15735639 "Systematic discovery of regulatory motifs in human promoters and 3' UTRs by comparison of several mammals" Xie X, Lu J, Kulbokas EJ, Golub TR, Mootha V, Lindblad-Toh K, Lander ES, Kellis M Nature. 434:338-345(2005).
2. PMID:15965474 "Identification of hundreds of conserved and nonconserved human microRNAs" Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z Nat Genet. 37:766-770(2005).
3. PMID:16274478 "Identification of clustered microRNAs using an ab initio prediction method" Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M BMC Bioinformatics. 6:267(2005).
4. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).