Stem-loop sequence hsa-mir-450a-2

AccessionMI0003187 (change log)
Previous IDshsa-mir-450-2
Symbol HGNC:MIR450A2
DescriptionHomo sapiens miR-450a-2 stem-loop
Gene family MIPF0000128; mir-450
Literature search

21 open access papers mention hsa-mir-450a-2
(43 sentences)

Stem-loop
   -ccaaagaaa     u       uuu     u               aa 
5'           gaugc aaacuau   ugcga guguuccuaauaugu  u
             ||||| |||||||   ||||| |||||||||||||||  a
3'           cuaug uuugaua   acguu uacagggguuaugua  u
   gguauaauaa     u       cuu     u               aa 
Get sequence
Deep sequencing
51161 reads, 276 reads per million, 157 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chrX: 134540508-134540607 [-]
intergenic
Clustered miRNAs
< 10kb from hsa-mir-450a-2
hsa-mir-424chrX: 134546614-134546711 [-]
hsa-mir-503chrX: 134546328-134546398 [-]
hsa-mir-542chrX: 134541341-134541437 [-]
hsa-mir-450a-2chrX: 134540508-134540607 [-]
hsa-mir-450a-1chrX: 134540341-134540431 [-]
hsa-mir-450bchrX: 134540185-134540262 [-]
Database links

Mature sequence hsa-miR-450a-5p

Accession MIMAT0001545
Previous IDshsa-miR-450;hsa-miR-450a
Sequence

23 - 

uuuugcgauguguuccuaauau

 - 44

Get sequence
Deep sequencing98394 reads, 157 experiments
Evidence experimental; array-cloned [1,3], cloned [1,4]
Database links
Predicted targets

Mature sequence hsa-miR-450a-2-3p

Accession MIMAT0031074
Sequence

58 - 

auuggggacauuuugcauucau

 - 79

Get sequence
Deep sequencing2622 reads, 112 experiments
Evidence not experimental
Database links
Predicted targets

References

1
PMID:15735639 "Systematic discovery of regulatory motifs in human promoters and 3' UTRs by comparison of several mammals" Xie X, Lu J, Kulbokas EJ, Golub TR, Mootha V, Lindblad-Toh K, Lander ES, Kellis M Nature. 434:338-345(2005).
2
PMID:15965474 "Identification of hundreds of conserved and nonconserved human microRNAs" Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z Nat Genet. 37:766-770(2005).
3
PMID:16274478 "Identification of clustered microRNAs using an ab initio prediction method" Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M BMC Bioinformatics. 6:267(2005).
4
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).