|
miRBase |
|
Stem-loop sequence hsa-mir-502 |
|||||
| Accession | MI0003186 | ||||
| Symbol | HGNC:MIR502 | ||||
| Description | Homo sapiens miR-502 stem-loop | ||||
| Gene family | MIPF0000139; mir-500 | ||||
| Stem-loop |
u - uau ug uag ugg gcucccccucucu aauccuugc c ggugc ugc c ||||||||||||| ||||||||| | ||||| ||| u cgagggggagaga uuaggaacg g ccacg acg c u c --- gu -ua uaa |
||||
| Deep sequencing |
| ||||
| Comments |
Extensive cloning studies suggest that the 3' product may be the predominant one [2]. |
||||
| Genome context |
|
||||
| Clustered miRNAs | |||||
| Database links | |||||
Mature sequence hsa-miR-502-5p |
|
| Accession | MIMAT0002873 |
| Previous IDs | hsa-miR-502 |
| Sequence |
16 - auccuugcuaucugggugcua - 36 |
| Deep sequencing | 42 reads, 13 experiments |
| Evidence | experimental; array-cloned [1] |
| Validated targets |
|
| Predicted targets |
|
Mature sequence hsa-miR-502-3p |
|
| Accession | MIMAT0004775 |
| Sequence |
52 - aaugcaccugggcaaggauuca - 73 |
| Deep sequencing | 4562 reads, 22 experiments |
| Evidence | experimental; cloned [2] |
| Predicted targets |
|
References |
|
| 1 |
PMID:15965474
"Identification of hundreds of conserved and nonconserved human microRNAs"
Nat Genet. 37:766-770(2005).
|
| 2 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|