Stem-loop sequence hsa-mir-501

AccessionMI0003185 (change log)
Symbol HGNC:MIR501
DescriptionHomo sapiens miR-501 stem-loop
Gene family MIPF0000139; mir-500
Literature search

35 open access papers mention hsa-mir-501
(58 sentences)

Stem-loop
       u       -u       u u   u     agag   uuu 
5' gcuc uccucuc  aauccuu g ccc gggug    ugc   c
   |||| |||||||  ||||||| | ||| |||||    |||   u
3' cgag gggagag  uuaggaa c ggg cccac    acg   g
       u       uc       - -   -     -gua   uaa 
Get sequence
Deep sequencing
54771 reads, 53.2 reads per million, 156 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chrX: 50009722-50009805 [+]
sense
OTTHUMT00000056562 ; CCNB3-005; intron 1
OTTHUMT00000056558 ; CCNB3-001; intron 1
OTTHUMT00000056559 ; CCNB3-002; intron 1
OTTHUMT00000056560 ; CCNB3-003; intron 1
OTTHUMT00000056561 ; CCNB3-004; intron 2
ENST00000491907 ; CCNB3-005; intron 1
ENST00000376042 ; CCNB3-001; intron 1
ENST00000376038 ; CCNB3-002; intron 1
ENST00000476167 ; CCNB3-003; intron 1
ENST00000493507 ; CCNB3-004; intron 2
Clustered miRNAs
< 10kb from hsa-mir-501
hsa-mir-532chrX: 50003148-50003238 [+]
hsa-mir-188chrX: 50003503-50003588 [+]
hsa-mir-500achrX: 50008431-50008514 [+]
hsa-mir-362chrX: 50008964-50009028 [+]
hsa-mir-501chrX: 50009722-50009805 [+]
hsa-mir-500bchrX: 50010672-50010750 [+]
hsa-mir-660chrX: 50013241-50013337 [+]
hsa-mir-502chrX: 50014598-50014683 [+]
Database links

Mature sequence hsa-miR-501-5p

Accession MIMAT0002872
Previous IDshsa-miR-501
Sequence

14 - 

aauccuuugucccugggugaga

 - 35

Get sequence
Deep sequencing5759 reads, 142 experiments
Evidence experimental; array-cloned [1], cloned [2]
Database links
Predicted targets

Mature sequence hsa-miR-501-3p

Accession MIMAT0004774
Sequence

51 - 

aaugcacccgggcaaggauucu

 - 72

Get sequence
Deep sequencing48978 reads, 153 experiments
Evidence experimental; cloned [2]
Database links
Predicted targets

References

1
PMID:15965474 "Identification of hundreds of conserved and nonconserved human microRNAs" Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z Nat Genet. 37:766-770(2005).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).