Stem-loop sequence hsa-mir-499a

AccessionMI0003183
Previous IDshsa-mir-499
Symbol HGNC:MIR499
DescriptionHomo sapiens miR-499a stem-loop
Gene family MIPF0000173; mir-499
Stem-loop
            ccugu  cuu   -    c   u  ua        a          acucc 
5' gcccugucc     gc   ggg cggg ggc gu  agacuugc gugauguuua     u
   |||||||||     ||   ||| |||| ||| ||  |||||||| ||||||||||     c
3' ugggacggg     cg   ccc gccc ucg cg  ucugaacg cacuacaagu     u
            uccgu  cau   u    u   u  ug        a          gcacc 
Get sequence
Deep sequencing
8815 reads, 318 reads per million, 56 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context
Coordinates (GRCh38) Overlapping transcripts
chr20: 34990376-34990497 [+]
sense
OTTHUMT00000079023 ; DLGAP4-005; intron 1
ENST00000373913 ; DLGAP4-005; intron 1
Clustered miRNAs
< 10kb from hsa-mir-499a
hsa-mir-499achr20: 34990376-34990497 [+]
hsa-mir-499bchr20: 34990400-34990472 [-]
Database links

Mature sequence hsa-miR-499a-5p

Accession MIMAT0002870
Previous IDshsa-miR-499;hsa-miR-499-5p
Sequence

33 - 

uuaagacuugcagugauguuu

 - 53

Get sequence
Deep sequencing867 reads, 47 experiments
Evidence experimental; array-cloned [1], cloned [2]
Validated targets
Predicted targets

Mature sequence hsa-miR-499a-3p

Accession MIMAT0004772
Previous IDshsa-miR-499-3p
Sequence

70 - 

aacaucacagcaagucugugcu

 - 91

Get sequence
Evidence experimental; cloned [2]
Predicted targets

References

1
PMID:15965474 "Identification of hundreds of conserved and nonconserved human microRNAs" Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z Nat Genet. 37:766-770(2005).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).