Stem-loop sequence hsa-mir-499a

Accession MI0003183
Previous IDs hsa-mir-499
Symbol HGNC:MIR499
Description Homo sapiens miR-499a stem-loop
Gene family MIPF0000173; mir-499
Stem-loop 
         ccugu  cuu   -    c   u  ua        a          acucc 
gcccugucc     gc   ggg cggg ggc gu  agacuugc gugauguuua     u
|||||||||     ||   ||| |||| ||| ||  |||||||| ||||||||||     c
ugggacggg     cg   ccc gccc ucg cg  ucugaacg cacuacaagu     u
         uccgu  cau   u    u   u  ug        a          gcacc
Get sequence
Deep sequencing
446 reads, 14 experiments
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr20: 33578179-33578300 [+]
sense
OTTHUMT00000078833 ; MYH7B-001; intron 20
OTTHUMT00000078833 ; MYH7B-001; intron 20
OTTHUMT00000078833 ; MYH7B-001; intron 20
ENST00000262873 ; MYH7B-001; intron 20
ENST00000262873 ; MYH7B-001; intron 20
ENST00000262873 ; MYH7B-001; intron 20
Clustered miRNAs
< 10kb from hsa-mir-499a
hsa-mir-499a chr20: 33578179-33578300 [+]
hsa-mir-499b chr20: 33578203-33578275 [-]
Database links

Mature sequence hsa-miR-499a-5p

Accession MIMAT0002870
Previous IDs hsa-miR-499;hsa-miR-499-5p
Sequence

33 -  

uuaagacuugcagugauguuu

 - 53

Get sequence
Deep sequencing 446 reads, 14 experiments
Evidence experimental; array-cloned [1], cloned [2]
Validated targets
Predicted targets

Mature sequence hsa-miR-499a-3p

Accession MIMAT0004772
Previous IDs hsa-miR-499-3p
Sequence

70 -  

aacaucacagcaagucugugcu

 - 91

Get sequence
Evidence experimental; cloned [2]
Predicted targets

References

1
PMID:15965474 "Identification of hundreds of conserved and nonconserved human microRNAs" Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z Nat Genet. 37:766-770(2005).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).