Stem-loop sequence hsa-mir-519a-2

Accession MI0003182
Symbol HGNC:MIR519A2
Description Homo sapiens miR-519a-2 stem-loop
Gene family MIPF0000020; mir-515
Stem-loop 
        u   u c     c     a         guug  u 
ucucaggc gug c cucua aggga gcgcuuucu    uc g
|||||||| ||| | ||||| ||||| |||||||||    || a
agaguuug cau g gagau uuccu cgugaaagg    ag a
        u   u u     u     a         --aa  a
Get sequence
Deep sequencing
33 reads, 6 experiments
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr19: 54265598-54265684 [+]
intergenic
Clustered miRNAs
< 10kb from hsa-mir-519a-2
hsa-mir-519a-1 chr19: 54255651-54255735 [+]
hsa-mir-527 chr19: 54257272-54257356 [+]
hsa-mir-516a-1 chr19: 54259995-54260084 [+]
hsa-mir-1283-2 chr19: 54261486-54261572 [+]
hsa-mir-516a-2 chr19: 54264387-54264476 [+]
hsa-mir-519a-2 chr19: 54265598-54265684 [+]
Database links

Mature sequence hsa-miR-519a-3p

Accession MIMAT0002869
Previous IDs hsa-miR-519a
Sequence

54 -  

aaagugcauccuuuuagagugu

 - 75

Get sequence
Deep sequencing 58 reads, 6 experiments
Evidence experimental; array-cloned [1], cloned [2]
Validated targets
Predicted targets

References

1
PMID:15965474 "Identification of hundreds of conserved and nonconserved human microRNAs" Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z Nat Genet. 37:766-770(2005).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).