Stem-loop sequence hsa-mir-519a-2

AccessionMI0003182 (change log)
Symbol HGNC:MIR519A2
DescriptionHomo sapiens miR-519a-2 stem-loop
Gene family MIPF0000020; mir-515
Literature search

34 open access papers mention hsa-mir-519a-2
(224 sentences)

Stem-loop
           u   u c     c     a         guug  u 
5' ucucaggc gug c cucua aggga gcgcuuucu    uc g
   |||||||| ||| | ||||| ||||| |||||||||    || a
3' agaguuug cau g gagau uuccu cgugaaagg    ag a
           u   u u     u     a         --aa  a 
Get sequence
Deep sequencing
4705 reads, 8.82 reads per million, 68 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr19: 53762344-53762430 [+]
sense
OTTHUMT00000464285 ; VN1R2-001; 3'UTR (exon 1)
ENST00000341702 ; VN1R2-001; 3'UTR (exon 1)
Clustered miRNAs
< 10kb from hsa-mir-519a-2
hsa-mir-519a-1chr19: 53752397-53752481 [+]
hsa-mir-527chr19: 53754018-53754102 [+]
hsa-mir-516a-1chr19: 53756741-53756830 [+]
hsa-mir-1283-2chr19: 53758232-53758318 [+]
hsa-mir-516a-2chr19: 53761133-53761222 [+]
hsa-mir-519a-2chr19: 53762344-53762430 [+]
Database links

Mature sequence hsa-miR-519a-2-5p

Accession MIMAT0037327
Sequence

15 - 

ccucuacagggaagcgcuuuc

 - 35

Get sequence
Deep sequencing564 reads, 30 experiments
Evidence experimental; Illumina [3]

Mature sequence hsa-miR-519a-3p

Accession MIMAT0002869
Previous IDshsa-miR-519a
Sequence

54 - 

aaagugcauccuuuuagagugu

 - 75

Get sequence
Deep sequencing8268 reads, 54 experiments
Evidence experimental; array-cloned [1], cloned [2]
Database links
Predicted targets

References

1
PMID:15965474 "Identification of hundreds of conserved and nonconserved human microRNAs" Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z Nat Genet. 37:766-770(2005).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:25822230 "Selective microRNA-Offset RNA expression in human embryonic stem cells" Asikainen S, Heikkinen L, Juhila J, Holm F, Weltner J, Trokovic R, Mikkola M, Toivonen S, Balboa D, Lampela R, Icay K, Tuuri T, Otonkoski T, Wong G, Hovatta O PLoS One. 10:e0116668(2015).