Stem-loop sequence hsa-mir-516a-2

AccessionMI0003181 (change log)
Previous IDshsa-mir-516-2
Symbol HGNC:MIR516A2
DescriptionHomo sapiens miR-516a-2 stem-loop
Gene family MIPF0000020; mir-515
Literature search

25 open access papers mention hsa-mir-516a-2
(63 sentences)

Stem-loop
        gg            c    aaa            guug  u 
5' ucuca  uugugaccuucu gagg   gaagcacuuucu    uc g
   |||||  |||||||||||| ||||   ||||||||||||    || a
3' agagu  ggcauugggaga uuuc   cuucgugaaaga    ag a
        uu            c    ---            --aa  a 
Get sequence
Deep sequencing
15042 reads, 32.6 reads per million, 89 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr19: 53761133-53761222 [+]
intergenic
Clustered miRNAs
< 10kb from hsa-mir-516a-2
hsa-mir-522chr19: 53751211-53751297 [+]
hsa-mir-519a-1chr19: 53752397-53752481 [+]
hsa-mir-527chr19: 53754018-53754102 [+]
hsa-mir-516a-1chr19: 53756741-53756830 [+]
hsa-mir-1283-2chr19: 53758232-53758318 [+]
hsa-mir-516a-2chr19: 53761133-53761222 [+]
hsa-mir-519a-2chr19: 53762344-53762430 [+]
Database links

Mature sequence hsa-miR-516a-5p

Accession MIMAT0004770
Sequence

16 - 

uucucgaggaaagaagcacuuuc

 - 38

Get sequence
Deep sequencing29604 reads, 75 experiments
Evidence experimental; cloned [2]
Database links
Predicted targets

Mature sequence hsa-miR-516a-3p

Accession MIMAT0006778
Sequence

61 - 

ugcuuccuuucagagggu

 - 78

Get sequence
Deep sequencing454 reads, 26 experiments
Evidence experimental; array-cloned [1]
Predicted targets

References

1
PMID:15965474 "Identification of hundreds of conserved and nonconserved human microRNAs" Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z Nat Genet. 37:766-770(2005).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).