Stem-loop sequence hsa-mir-519a-1

AccessionMI0003178
Symbol HGNC:MIR519A1
DescriptionHomo sapiens miR-519a-1 stem-loop
Gene family MIPF0000020; mir-515
Stem-loop
          u                 a         guug  u 
5' cucaggc gugacacucuagaggga gcgcuuucu    uc g
   ||||||| ||||||||||||||||| |||||||||    || a
3' gaguuug cauugugagauuuuccu cgugaaagg    ag a
          u                 a         --aa  a 
Get sequence
Deep sequencing
108 reads, 318 reads per million, 27 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38) Overlapping transcripts
chr19: 53752397-53752481 [+]
antisense
OTTHUMT00000464189 ; ZNF677-001; intron 3
OTTHUMT00000464190 ; ZNF677-004; intron 3
OTTHUMT00000464279 ; ZNF677-007; intron 3
OTTHUMT00000464191 ; ZNF677-002; intron 3
OTTHUMT00000464280 ; ZNF677-008; intron 3
OTTHUMT00000464281 ; ZNF677-006; intron 3
OTTHUMT00000464282 ; ZNF677-005; intron 3
OTTHUMT00000464283 ; ZNF677-009; exon 4
ENST00000598513 ; ZNF677-001; intron 3
ENST00000594517 ; ZNF677-004; intron 3
ENST00000599012 ; ZNF677-007; intron 3
ENST00000594681 ; ZNF677-002; intron 3
ENST00000598806 ; ZNF677-008; intron 3
ENST00000601828 ; ZNF677-006; intron 3
ENST00000601413 ; ZNF677-005; intron 3
ENST00000333952 ; ZNF677-201; intron 3
ENST00000595293 ; ZNF677-009; exon 4
Clustered miRNAs
< 10kb from hsa-mir-519a-1
hsa-mir-520hchr19: 53742512-53742599 [+]
hsa-mir-521-1chr19: 53748636-53748722 [+]
hsa-mir-522chr19: 53751211-53751297 [+]
hsa-mir-519a-1chr19: 53752397-53752481 [+]
hsa-mir-527chr19: 53754018-53754102 [+]
hsa-mir-516a-1chr19: 53756741-53756830 [+]
hsa-mir-1283-2chr19: 53758232-53758318 [+]
hsa-mir-516a-2chr19: 53761133-53761222 [+]
hsa-mir-519a-2chr19: 53762344-53762430 [+]
Database links

Mature sequence hsa-miR-519a-5p

Accession MIMAT0005452
Previous IDshsa-miR-519a*
Sequence

15 - 

cucuagagggaagcgcuuucug

 - 36

Get sequence
Deep sequencing23 reads, 11 experiments
Evidence experimental; array-cloned [1], cloned [2]
Predicted targets

Mature sequence hsa-miR-519a-3p

Accession MIMAT0002869
Previous IDshsa-miR-519a
Sequence

53 - 

aaagugcauccuuuuagagugu

 - 74

Get sequence
Deep sequencing50 reads, 6 experiments
Evidence experimental; array-cloned [1], cloned [2]
Validated targets
Predicted targets

References

1
PMID:15965474 "Identification of hundreds of conserved and nonconserved human microRNAs" Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z Nat Genet. 37:766-770(2005).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).