Stem-loop sequence hsa-mir-519a-1

AccessionMI0003178 (change log)
Symbol HGNC:MIR519A1
DescriptionHomo sapiens miR-519a-1 stem-loop
Gene family MIPF0000020; mir-515
Literature search

34 open access papers mention hsa-mir-519a-1
(224 sentences)

Stem-loop
          u                 a         guug  u 
5' cucaggc gugacacucuagaggga gcgcuuucu    uc g
   ||||||| ||||||||||||||||| |||||||||    || a
3' gaguuug cauugugagauuuuccu cgugaaagg    ag a
          u                 a         --aa  a 
Get sequence
Deep sequencing
5621 reads, 11.7 reads per million, 77 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr19: 53752397-53752481 [+]
antisense
OTTHUMT00000464189 ; ZNF677-001; intron 3
OTTHUMT00000464190 ; ZNF677-004; intron 3
OTTHUMT00000464279 ; ZNF677-007; intron 3
OTTHUMT00000464191 ; ZNF677-002; intron 3
OTTHUMT00000464280 ; ZNF677-008; intron 3
OTTHUMT00000464281 ; ZNF677-006; intron 3
OTTHUMT00000464282 ; ZNF677-005; intron 3
OTTHUMT00000464283 ; ZNF677-009; exon 4
ENST00000598513 ; ZNF677-001; intron 3
ENST00000594517 ; ZNF677-004; intron 3
ENST00000599012 ; ZNF677-007; intron 3
ENST00000594681 ; ZNF677-002; intron 3
ENST00000598806 ; ZNF677-008; intron 3
ENST00000601828 ; ZNF677-006; intron 3
ENST00000601413 ; ZNF677-005; intron 3
ENST00000333952 ; ZNF677-201; intron 3
ENST00000595293 ; ZNF677-009; exon 4
Clustered miRNAs
< 10kb from hsa-mir-519a-1
hsa-mir-520hchr19: 53742512-53742599 [+]
hsa-mir-521-1chr19: 53748636-53748722 [+]
hsa-mir-522chr19: 53751211-53751297 [+]
hsa-mir-519a-1chr19: 53752397-53752481 [+]
hsa-mir-527chr19: 53754018-53754102 [+]
hsa-mir-516a-1chr19: 53756741-53756830 [+]
hsa-mir-1283-2chr19: 53758232-53758318 [+]
hsa-mir-516a-2chr19: 53761133-53761222 [+]
hsa-mir-519a-2chr19: 53762344-53762430 [+]
Database links

Mature sequence hsa-miR-519a-5p

Accession MIMAT0005452
Previous IDshsa-miR-519a*
Sequence

15 - 

cucuagagggaagcgcuuucug

 - 36

Get sequence
Deep sequencing1475 reads, 53 experiments
Evidence experimental; array-cloned [1], cloned [2]
Database links
Predicted targets

Mature sequence hsa-miR-519a-3p

Accession MIMAT0002869
Previous IDshsa-miR-519a
Sequence

53 - 

aaagugcauccuuuuagagugu

 - 74

Get sequence
Deep sequencing8268 reads, 54 experiments
Evidence experimental; array-cloned [1], cloned [2]
Database links
Predicted targets

References

1
PMID:15965474 "Identification of hundreds of conserved and nonconserved human microRNAs" Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z Nat Genet. 37:766-770(2005).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).