Stem-loop sequence hsa-mir-522

AccessionMI0003177 (change log)
Symbol HGNC:MIR522
DescriptionHomo sapiens miR-522 stem-loop
Gene family MIPF0000020; mir-515
Literature search

16 open access papers mention hsa-mir-522
(140 sentences)

Stem-loop
         -  u   u c            g  c     guug  u 
5' ucucag gc gug c cucuagagggaa cg uuucu    uc g
   |||||| || ||| | |||||||||||| || |||||    || a
3' agaguu cg cau g gagauuucccuu gu aaaga    ag a
         u  -   u u            g  a     --aa  a 
Get sequence
Deep sequencing
3040 reads, 8.82 reads per million, 68 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr19: 53751211-53751297 [+]
antisense
OTTHUMT00000464189 ; ZNF677-001; intron 3
OTTHUMT00000464190 ; ZNF677-004; intron 3
OTTHUMT00000464279 ; ZNF677-007; intron 3
OTTHUMT00000464191 ; ZNF677-002; intron 3
OTTHUMT00000464280 ; ZNF677-008; intron 3
OTTHUMT00000464281 ; ZNF677-006; intron 3
OTTHUMT00000464282 ; ZNF677-005; intron 3
ENST00000598513 ; ZNF677-001; intron 3
ENST00000594517 ; ZNF677-004; intron 3
ENST00000599012 ; ZNF677-007; intron 3
ENST00000594681 ; ZNF677-002; intron 3
ENST00000598806 ; ZNF677-008; intron 3
ENST00000601828 ; ZNF677-006; intron 3
ENST00000601413 ; ZNF677-005; intron 3
ENST00000333952 ; ZNF677-201; intron 3
Clustered miRNAs
< 10kb from hsa-mir-522
hsa-mir-517cchr19: 53741313-53741407 [+]
hsa-mir-520hchr19: 53742512-53742599 [+]
hsa-mir-521-1chr19: 53748636-53748722 [+]
hsa-mir-522chr19: 53751211-53751297 [+]
hsa-mir-519a-1chr19: 53752397-53752481 [+]
hsa-mir-527chr19: 53754018-53754102 [+]
hsa-mir-516a-1chr19: 53756741-53756830 [+]
hsa-mir-1283-2chr19: 53758232-53758318 [+]
hsa-mir-516a-2chr19: 53761133-53761222 [+]
Database links

Mature sequence hsa-miR-522-5p

Accession MIMAT0005451
Previous IDshsa-miR-522*
Sequence

16 - 

cucuagagggaagcgcuuucug

 - 37

Get sequence
Deep sequencing509 reads, 49 experiments
Evidence experimental; array-cloned [1], cloned [2]
Database links
Predicted targets

Mature sequence hsa-miR-522-3p

Accession MIMAT0002868
Previous IDshsa-miR-522
Sequence

54 - 

aaaaugguucccuuuagagugu

 - 75

Get sequence
Deep sequencing2520 reads, 38 experiments
Evidence experimental; array-cloned [1], cloned [2-3]
Predicted targets

References

1
PMID:15965474 "Identification of hundreds of conserved and nonconserved human microRNAs" Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z Nat Genet. 37:766-770(2005).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).