|
miRBase |
|
Stem-loop sequence hsa-mir-522 |
|||||
| Accession | MI0003177 | ||||
| Symbol | HGNC:MIR522 | ||||
| Description | Homo sapiens miR-522 stem-loop | ||||
| Gene family | MIPF0000020; mir-515 | ||||
| Stem-loop |
- u u c g c guug u ucucag gc gug c cucuagagggaa cg uuucu uc g |||||| || ||| | |||||||||||| || ||||| || a agaguu cg cau g gagauuucccuu gu aaaga ag a u - u u g a --aa a |
||||
| Deep sequencing |
| ||||
| Genome context |
|
||||
| Clustered miRNAs | |||||
| Database links | |||||
Mature sequence hsa-miR-522-5p |
|
| Accession | MIMAT0005451 |
| Previous IDs | hsa-miR-522* |
| Sequence |
16 - cucuagagggaagcgcuuucug - 37 |
| Deep sequencing | 8 reads, 2 experiments |
| Evidence | experimental; array-cloned [1], cloned [2] |
| Predicted targets |
|
Mature sequence hsa-miR-522-3p |
|
| Accession | MIMAT0002868 |
| Previous IDs | hsa-miR-522 |
| Sequence |
54 - aaaaugguucccuuuagagugu - 75 |
| Deep sequencing | 2 reads, 1 experiments |
| Evidence | experimental; array-cloned [1], cloned [2-3] |
| Predicted targets |
|
References |
|
| 1 |
PMID:15965474
"Identification of hundreds of conserved and nonconserved human microRNAs"
Nat Genet. 37:766-770(2005).
|
| 2 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
| 3 |
PMID:17616659
"Patterns of known and novel small RNAs in human cervical cancer"
Cancer Res. 67:6031-6043(2007).
|