Stem-loop sequence hsa-mir-517c

AccessionMI0003174
Symbol HGNC:MIR517C
DescriptionHomo sapiens miR-517c stem-loop
Gene family MIPF0000020; mir-515
Stem-loop
   gaaga              c       u   a    u    guugu 
5'      ucucaggcagugac cucuaga gga gcac gucu     c
        |||||||||||||| ||||||| ||| |||| ||||     u
3'      agaguuugucauug gagauuu ccu cgug uaga     a
   cuaaa              u       u   a    c    aaaga 
Get sequence
Deep sequencing
73 reads, 176 reads per million, 16 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38) Overlapping transcripts
chr19: 53741313-53741407 [+]
antisense
OTTHUMT00000464189 ; ZNF677-001; exon 5
ENST00000598513 ; ZNF677-001; exon 5
ENST00000333952 ; ZNF677-201; exon 5
Clustered miRNAs
< 10kb from hsa-mir-517c
hsa-mir-518dchr19: 53734877-53734963 [+]
hsa-mir-516b-1chr19: 53736845-53736934 [+]
hsa-mir-518a-2chr19: 53739333-53739419 [+]
hsa-mir-517cchr19: 53741313-53741407 [+]
hsa-mir-520hchr19: 53742512-53742599 [+]
hsa-mir-521-1chr19: 53748636-53748722 [+]
hsa-mir-522chr19: 53751211-53751297 [+]
Database links

Mature sequence hsa-miR-517-5p

Accession MIMAT0002851
Previous IDshsa-miR-517*
Sequence

20 - 

ccucuagauggaagcacugucu

 - 41

Get sequence
Deep sequencing3 reads, 1 experiments
Evidence experimental; array-cloned [1]
Predicted targets

Mature sequence hsa-miR-517c-3p

Accession MIMAT0002866
Previous IDshsa-miR-517c
Sequence

57 - 

aucgugcauccuuuuagagugu

 - 78

Get sequence
Deep sequencing8 reads, 5 experiments
Evidence experimental; array-cloned [1], cloned [2]
Predicted targets

References

1
PMID:15965474 "Identification of hundreds of conserved and nonconserved human microRNAs" Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z Nat Genet. 37:766-770(2005).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).